Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631209_at:

>probe:Drosophila_2:1631209_at:304:433; Interrogation_Position=1041; Antisense; GAGTGGTGCGTGCAACAGTCCAAAT
>probe:Drosophila_2:1631209_at:440:349; Interrogation_Position=1069; Antisense; GCAGGATGTTTGACCAGCTGGCCAA
>probe:Drosophila_2:1631209_at:541:659; Interrogation_Position=1126; Antisense; TAAGCTACGAGAACCCGCGGAGCAT
>probe:Drosophila_2:1631209_at:709:39; Interrogation_Position=1149; Antisense; ATCTGGGCCAAGATGCATCTGTTGC
>probe:Drosophila_2:1631209_at:206:213; Interrogation_Position=1174; Antisense; AAGAGCACAAGCTGGGTGGCGCCAT
>probe:Drosophila_2:1631209_at:132:577; Interrogation_Position=1199; Antisense; GGCCTGGACCATTGACGTAGACGAT
>probe:Drosophila_2:1631209_at:690:115; Interrogation_Position=1246; Antisense; AGCATGGATTGCTCCGTGTGATCTT
>probe:Drosophila_2:1631209_at:83:407; Interrogation_Position=1330; Antisense; GACTGTGCCCACATGATGGCTTTAG
>probe:Drosophila_2:1631209_at:390:699; Interrogation_Position=1350; Antisense; TTTAGCCGCGATGGTTGGGATTGCC
>probe:Drosophila_2:1631209_at:260:317; Interrogation_Position=1372; Antisense; GCCGATTGTATCATGAGTGCCGCGA
>probe:Drosophila_2:1631209_at:442:137; Interrogation_Position=1414; Antisense; ACGAGTGCCTCGAGGGTCAGTATTT
>probe:Drosophila_2:1631209_at:12:323; Interrogation_Position=1462; Antisense; GCCCAGCCGCTGAGGTCAAGTGTGA
>probe:Drosophila_2:1631209_at:123:385; Interrogation_Position=1490; Antisense; GAACTTTGTCATTTGGCGACCGGGA
>probe:Drosophila_2:1631209_at:658:525; Interrogation_Position=1511; Antisense; GGGAATGCCCGTTTATAGCTACGAC

Paste this into a BLAST search page for me
GAGTGGTGCGTGCAACAGTCCAAATGCAGGATGTTTGACCAGCTGGCCAATAAGCTACGAGAACCCGCGGAGCATATCTGGGCCAAGATGCATCTGTTGCAAGAGCACAAGCTGGGTGGCGCCATGGCCTGGACCATTGACGTAGACGATAGCATGGATTGCTCCGTGTGATCTTGACTGTGCCCACATGATGGCTTTAGTTTAGCCGCGATGGTTGGGATTGCCGCCGATTGTATCATGAGTGCCGCGAACGAGTGCCTCGAGGGTCAGTATTTGCCCAGCCGCTGAGGTCAAGTGTGAGAACTTTGTCATTTGGCGACCGGGAGGGAATGCCCGTTTATAGCTACGAC

Full Affymetrix probeset data:

Annotations for 1631209_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime