FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631210_at:

>probe:Drosophila_2:1631210_at:610:87; Interrogation_Position=1346; Antisense; AGTCCCTAATGAACTCCAGTGCCTA
>probe:Drosophila_2:1631210_at:51:267; Interrogation_Position=1362; Antisense; CAGTGCCTATCGTAGCATCTGCAAA
>probe:Drosophila_2:1631210_at:109:617; Interrogation_Position=1381; Antisense; TGCAAAGCTCAGCAGCCAGTTCTTG
>probe:Drosophila_2:1631210_at:424:523; Interrogation_Position=1458; Antisense; GGGCGTGCAAGAAGTCCTGGATAAT
>probe:Drosophila_2:1631210_at:546:21; Interrogation_Position=1481; Antisense; ATATCCAGCGCTACTGCAATCAGGT
>probe:Drosophila_2:1631210_at:509:495; Interrogation_Position=1520; Antisense; GTCAGATGTCGGCTGAACTGCCCAG
>probe:Drosophila_2:1631210_at:578:87; Interrogation_Position=1543; Antisense; AGTCTCGAGGACATCTTGATACCCA
>probe:Drosophila_2:1631210_at:425:177; Interrogation_Position=1578; Antisense; AAACGGTGGACTTTGTCAGCCAGCA
>probe:Drosophila_2:1631210_at:535:125; Interrogation_Position=1595; Antisense; AGCCAGCAGCCATGAGCTCTAGGAC
>probe:Drosophila_2:1631210_at:337:677; Interrogation_Position=1614; Antisense; TAGGACCCTCGCAGGTAGTCAGAAA
>probe:Drosophila_2:1631210_at:378:389; Interrogation_Position=1666; Antisense; GAAACGCCCAACGATAGTACGGATG
>probe:Drosophila_2:1631210_at:374:373; Interrogation_Position=1702; Antisense; GAAGTGGATGACTTCCAGCTCTCCT
>probe:Drosophila_2:1631210_at:24:557; Interrogation_Position=1749; Antisense; GGACGATGACTGTGGCCTCAAGTAT
>probe:Drosophila_2:1631210_at:233:221; Interrogation_Position=1776; Antisense; AAGTGGAGCAACTACGAGCCGGCCC

Paste this into a BLAST search page for me
AGTCCCTAATGAACTCCAGTGCCTACAGTGCCTATCGTAGCATCTGCAAATGCAAAGCTCAGCAGCCAGTTCTTGGGGCGTGCAAGAAGTCCTGGATAATATATCCAGCGCTACTGCAATCAGGTGTCAGATGTCGGCTGAACTGCCCAGAGTCTCGAGGACATCTTGATACCCAAAACGGTGGACTTTGTCAGCCAGCAAGCCAGCAGCCATGAGCTCTAGGACTAGGACCCTCGCAGGTAGTCAGAAAGAAACGCCCAACGATAGTACGGATGGAAGTGGATGACTTCCAGCTCTCCTGGACGATGACTGTGGCCTCAAGTATAAGTGGAGCAACTACGAGCCGGCCC

Full Affymetrix probeset data:

Annotations for 1631210_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720