Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631211_at:

>probe:Drosophila_2:1631211_at:80:601; Interrogation_Position=245; Antisense; TGATGACTGTTCCATTTACGGCGGT
>probe:Drosophila_2:1631211_at:392:283; Interrogation_Position=284; Antisense; CTGCGGGTGCTAGGTGATCTCTGAC
>probe:Drosophila_2:1631211_at:437:451; Interrogation_Position=299; Antisense; GATCTCTGACCTGGAGTAGCCACAG
>probe:Drosophila_2:1631211_at:592:549; Interrogation_Position=332; Antisense; GGAGAGTCCGGAATTCAACTATCTT
>probe:Drosophila_2:1631211_at:498:163; Interrogation_Position=397; Antisense; AAATATCATTCAGTCCCAGTCCAGT
>probe:Drosophila_2:1631211_at:142:87; Interrogation_Position=414; Antisense; AGTCCAGTCCTTGTCGGAACAACAA
>probe:Drosophila_2:1631211_at:344:47; Interrogation_Position=464; Antisense; ATCCGTTTCCTAACCATGTGTGGTG
>probe:Drosophila_2:1631211_at:253:693; Interrogation_Position=506; Antisense; TTTGACCTGGCCTGCAATAATCCTC
>probe:Drosophila_2:1631211_at:411:255; Interrogation_Position=537; Antisense; CAACACTGCGTTTCACCGGTCGGGA
>probe:Drosophila_2:1631211_at:684:305; Interrogation_Position=576; Antisense; CCTGCGGTCCTTGCGATAAGTGTTA
>probe:Drosophila_2:1631211_at:639:117; Interrogation_Position=675; Antisense; AGCTCTGCACACTGGCGAGTACTCA
>probe:Drosophila_2:1631211_at:623:551; Interrogation_Position=731; Antisense; GGAAATGCGGTCTTATACTACTAAA
>probe:Drosophila_2:1631211_at:411:515; Interrogation_Position=763; Antisense; GTGTAGATCTTCTTGTACCAGCCAT
>probe:Drosophila_2:1631211_at:476:599; Interrogation_Position=776; Antisense; TGTACCAGCCATTTCCATGGGAAAC

Paste this into a BLAST search page for me
TGATGACTGTTCCATTTACGGCGGTCTGCGGGTGCTAGGTGATCTCTGACGATCTCTGACCTGGAGTAGCCACAGGGAGAGTCCGGAATTCAACTATCTTAAATATCATTCAGTCCCAGTCCAGTAGTCCAGTCCTTGTCGGAACAACAAATCCGTTTCCTAACCATGTGTGGTGTTTGACCTGGCCTGCAATAATCCTCCAACACTGCGTTTCACCGGTCGGGACCTGCGGTCCTTGCGATAAGTGTTAAGCTCTGCACACTGGCGAGTACTCAGGAAATGCGGTCTTATACTACTAAAGTGTAGATCTTCTTGTACCAGCCATTGTACCAGCCATTTCCATGGGAAAC

Full Affymetrix probeset data:

Annotations for 1631211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime