FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631212_at:

>probe:Drosophila_2:1631212_at:512:127; Interrogation_Position=113; Antisense; ACCATTTTGCCCCAGTCGAAGGAGG
>probe:Drosophila_2:1631212_at:707:371; Interrogation_Position=130; Antisense; GAAGGAGGCGCTTCTGAAGTCCTAT
>probe:Drosophila_2:1631212_at:540:373; Interrogation_Position=145; Antisense; GAAGTCCTATAATGCGCGCCTCAAG
>probe:Drosophila_2:1631212_at:166:653; Interrogation_Position=165; Antisense; TCAAGGACGACGTTCGCAGCATGCT
>probe:Drosophila_2:1631212_at:414:415; Interrogation_Position=229; Antisense; GAGCCACAGCCAGATTTCGAAGACC
>probe:Drosophila_2:1631212_at:200:585; Interrogation_Position=276; Antisense; TGGAAATGCAGGTCCGCGCGGCCAA
>probe:Drosophila_2:1631212_at:246:627; Interrogation_Position=310; Antisense; TGCCGGCGAGTCTCTGATGAAGCTG
>probe:Drosophila_2:1631212_at:659:445; Interrogation_Position=325; Antisense; GATGAAGCTGGTGGCCGACCTAAAA
>probe:Drosophila_2:1631212_at:276:153; Interrogation_Position=349; Antisense; ACAGTACCTAATCCTCAACGACTTT
>probe:Drosophila_2:1631212_at:658:251; Interrogation_Position=364; Antisense; CAACGACTTTCACTCGGTCAACGAG
>probe:Drosophila_2:1631212_at:690:439; Interrogation_Position=386; Antisense; GAGGCCATCACAAACAATTCGCAGC
>probe:Drosophila_2:1631212_at:103:549; Interrogation_Position=496; Antisense; GGAGTACTACACCAGCATTTTTAAG
>probe:Drosophila_2:1631212_at:530:285; Interrogation_Position=562; Antisense; CTGGCTTTGGCCGAACTGTAGAATT
>probe:Drosophila_2:1631212_at:428:559; Interrogation_Position=87; Antisense; GGACAATGGCCAGCGGATCCAGGAC

Paste this into a BLAST search page for me
ACCATTTTGCCCCAGTCGAAGGAGGGAAGGAGGCGCTTCTGAAGTCCTATGAAGTCCTATAATGCGCGCCTCAAGTCAAGGACGACGTTCGCAGCATGCTGAGCCACAGCCAGATTTCGAAGACCTGGAAATGCAGGTCCGCGCGGCCAATGCCGGCGAGTCTCTGATGAAGCTGGATGAAGCTGGTGGCCGACCTAAAAACAGTACCTAATCCTCAACGACTTTCAACGACTTTCACTCGGTCAACGAGGAGGCCATCACAAACAATTCGCAGCGGAGTACTACACCAGCATTTTTAAGCTGGCTTTGGCCGAACTGTAGAATTGGACAATGGCCAGCGGATCCAGGAC

Full Affymetrix probeset data:

Annotations for 1631212_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720