FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631213_at:

>probe:Drosophila_2:1631213_at:371:471; Interrogation_Position=1371; Antisense; GTTCGAGACCACCTGCTACAAGCTG
>probe:Drosophila_2:1631213_at:569:357; Interrogation_Position=1397; Antisense; GCAAGTACTTGCAGGAGATCGGGCT
>probe:Drosophila_2:1631213_at:176:225; Interrogation_Position=1447; Antisense; AAGGAACTGGTCAGCCAGGGCTACC
>probe:Drosophila_2:1631213_at:514:671; Interrogation_Position=1498; Antisense; TACCTTGGGATGGACGTGCACGACA
>probe:Drosophila_2:1631213_at:501:63; Interrogation_Position=1561; Antisense; ATGGTCTTCACCGTTGAGCCGGGCA
>probe:Drosophila_2:1631213_at:110:525; Interrogation_Position=1581; Antisense; GGGCATCTACATTGGCCAGGATTGC
>probe:Drosophila_2:1631213_at:496:41; Interrogation_Position=1633; Antisense; ATCGGCATCCGCATCGAAGACGATC
>probe:Drosophila_2:1631213_at:406:375; Interrogation_Position=1648; Antisense; GAAGACGATCTGCTCATCAACGAGA
>probe:Drosophila_2:1631213_at:706:139; Interrogation_Position=1673; Antisense; ACGGCCACGTGGAAGTTCTAACTGA
>probe:Drosophila_2:1631213_at:695:143; Interrogation_Position=1693; Antisense; ACTGAGGCGTGCGTCAAGGATCCAC
>probe:Drosophila_2:1631213_at:426:633; Interrogation_Position=1768; Antisense; TCCGCGGAGGCGTTTTAAGAGCTCA
>probe:Drosophila_2:1631213_at:329:679; Interrogation_Position=1811; Antisense; TAGTCATAAGCCTTTCATTCTCCCG
>probe:Drosophila_2:1631213_at:3:13; Interrogation_Position=1827; Antisense; ATTCTCCCGACAACCTTATGAGCTG
>probe:Drosophila_2:1631213_at:531:305; Interrogation_Position=1840; Antisense; CCTTATGAGCTGATTTGGGTCCTAA

Paste this into a BLAST search page for me
GTTCGAGACCACCTGCTACAAGCTGGCAAGTACTTGCAGGAGATCGGGCTAAGGAACTGGTCAGCCAGGGCTACCTACCTTGGGATGGACGTGCACGACAATGGTCTTCACCGTTGAGCCGGGCAGGGCATCTACATTGGCCAGGATTGCATCGGCATCCGCATCGAAGACGATCGAAGACGATCTGCTCATCAACGAGAACGGCCACGTGGAAGTTCTAACTGAACTGAGGCGTGCGTCAAGGATCCACTCCGCGGAGGCGTTTTAAGAGCTCATAGTCATAAGCCTTTCATTCTCCCGATTCTCCCGACAACCTTATGAGCTGCCTTATGAGCTGATTTGGGTCCTAA

Full Affymetrix probeset data:

Annotations for 1631213_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720