Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631214_at:

>probe:Drosophila_2:1631214_at:630:285; Interrogation_Position=313; Antisense; CGGCCTGGGCTACATTAGTGCCATA
>probe:Drosophila_2:1631214_at:446:43; Interrogation_Position=349; Antisense; ATCGAATGTGTTCCTGCGCGAGATC
>probe:Drosophila_2:1631214_at:597:3; Interrogation_Position=416; Antisense; ATTGGTCGGGTGACTCGGAATCTCC
>probe:Drosophila_2:1631214_at:530:647; Interrogation_Position=453; Antisense; TCAGCTGCGTGGATCTTGTCGAGCA
>probe:Drosophila_2:1631214_at:302:77; Interrogation_Position=477; Antisense; AGGATCCCGCGTTTGCCGATAAAGC
>probe:Drosophila_2:1631214_at:518:139; Interrogation_Position=502; Antisense; ACGGGAGTACTGCACTTCGGAAGAC
>probe:Drosophila_2:1631214_at:509:373; Interrogation_Position=571; Antisense; GAAGTTTACGCCTACGCAACAGTAC
>probe:Drosophila_2:1631214_at:30:89; Interrogation_Position=591; Antisense; AGTACGACCTCGTTTGGACCCAGTG
>probe:Drosophila_2:1631214_at:719:589; Interrogation_Position=645; Antisense; TGGTCTCGTTCTTTCGACGCATAAA
>probe:Drosophila_2:1631214_at:688:315; Interrogation_Position=766; Antisense; GCCTCTGGACAGCTATGAACACTTC
>probe:Drosophila_2:1631214_at:372:379; Interrogation_Position=797; Antisense; GAAGCCGGATTTCGCATTGTACGCA
>probe:Drosophila_2:1631214_at:261:223; Interrogation_Position=845; Antisense; AAGGGACTCTTTCCAGTGTACATGA
>probe:Drosophila_2:1631214_at:376:513; Interrogation_Position=860; Antisense; GTGTACATGATAGCCTGCAAACCCG
>probe:Drosophila_2:1631214_at:134:265; Interrogation_Position=874; Antisense; CTGCAAACCCGTCTCCAAGGAATAG

Paste this into a BLAST search page for me
CGGCCTGGGCTACATTAGTGCCATAATCGAATGTGTTCCTGCGCGAGATCATTGGTCGGGTGACTCGGAATCTCCTCAGCTGCGTGGATCTTGTCGAGCAAGGATCCCGCGTTTGCCGATAAAGCACGGGAGTACTGCACTTCGGAAGACGAAGTTTACGCCTACGCAACAGTACAGTACGACCTCGTTTGGACCCAGTGTGGTCTCGTTCTTTCGACGCATAAAGCCTCTGGACAGCTATGAACACTTCGAAGCCGGATTTCGCATTGTACGCAAAGGGACTCTTTCCAGTGTACATGAGTGTACATGATAGCCTGCAAACCCGCTGCAAACCCGTCTCCAAGGAATAG

Full Affymetrix probeset data:

Annotations for 1631214_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime