Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631218_at:

>probe:Drosophila_2:1631218_at:150:323; Interrogation_Position=1006; Antisense; GCGCCAGCGCCAGGATTTTGAGCAG
>probe:Drosophila_2:1631218_at:159:405; Interrogation_Position=1031; Antisense; GACTCAACGGGTAGTGTTTCGCCAG
>probe:Drosophila_2:1631218_at:725:479; Interrogation_Position=1046; Antisense; GTTTCGCCAGCTTACTATGGAGCAA
>probe:Drosophila_2:1631218_at:547:93; Interrogation_Position=1078; Antisense; AGTTGCCAATCCTATGTCGCCGTAT
>probe:Drosophila_2:1631218_at:657:685; Interrogation_Position=1100; Antisense; TATCTCCGCCATCACTTGAGCTATG
>probe:Drosophila_2:1631218_at:507:679; Interrogation_Position=1121; Antisense; TATGGACCCAGTGGAGCTGCCGGAT
>probe:Drosophila_2:1631218_at:518:273; Interrogation_Position=1156; Antisense; CATTGCAGCTGCCTATTTTGGTGGA
>probe:Drosophila_2:1631218_at:534:15; Interrogation_Position=1170; Antisense; ATTTTGGTGGAGTTCCTCCGCAGAT
>probe:Drosophila_2:1631218_at:233:195; Interrogation_Position=1225; Antisense; AACTGTCGCGCCTGTTAGTCCTGTG
>probe:Drosophila_2:1631218_at:648:225; Interrogation_Position=1290; Antisense; CAAGGCCTTCAACCTCAACGAAAAG
>probe:Drosophila_2:1631218_at:473:343; Interrogation_Position=1320; Antisense; GCTTCAGCATTTCAGCCATTTTGGC
>probe:Drosophila_2:1631218_at:276:467; Interrogation_Position=1378; Antisense; GTTGGAGTCATCTTCTGTTGTGATT
>probe:Drosophila_2:1631218_at:451:177; Interrogation_Position=1409; Antisense; AAACGTGTGCATATACTTTGTAAGC
>probe:Drosophila_2:1631218_at:621:379; Interrogation_Position=1463; Antisense; GAACCAAGCTGCAATCATATACATT

Paste this into a BLAST search page for me
GCGCCAGCGCCAGGATTTTGAGCAGGACTCAACGGGTAGTGTTTCGCCAGGTTTCGCCAGCTTACTATGGAGCAAAGTTGCCAATCCTATGTCGCCGTATTATCTCCGCCATCACTTGAGCTATGTATGGACCCAGTGGAGCTGCCGGATCATTGCAGCTGCCTATTTTGGTGGAATTTTGGTGGAGTTCCTCCGCAGATAACTGTCGCGCCTGTTAGTCCTGTGCAAGGCCTTCAACCTCAACGAAAAGGCTTCAGCATTTCAGCCATTTTGGCGTTGGAGTCATCTTCTGTTGTGATTAAACGTGTGCATATACTTTGTAAGCGAACCAAGCTGCAATCATATACATT

Full Affymetrix probeset data:

Annotations for 1631218_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime