FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631220_at:

>probe:Drosophila_2:1631220_at:334:377; Interrogation_Position=245; Antisense; GAAGCAGTAAGATGTCCTCACCACT
>probe:Drosophila_2:1631220_at:421:649; Interrogation_Position=296; Antisense; TCAGCAGCACAATATGCCAGGGCCT
>probe:Drosophila_2:1631220_at:536:83; Interrogation_Position=314; Antisense; AGGGCCTGCCAGATTTGCACAAACA
>probe:Drosophila_2:1631220_at:284:119; Interrogation_Position=353; Antisense; AGCTGCAGTCAGTCTTCCACGTGGA
>probe:Drosophila_2:1631220_at:124:87; Interrogation_Position=390; Antisense; AGTGCCCCACTATGAGCTCGTGCAG
>probe:Drosophila_2:1631220_at:150:319; Interrogation_Position=489; Antisense; GCCGCCCCACCACGTGAAAAAGGAT
>probe:Drosophila_2:1631220_at:362:545; Interrogation_Position=510; Antisense; GGATCTCAGCAAGAACGCCTACTAC
>probe:Drosophila_2:1631220_at:580:117; Interrogation_Position=535; Antisense; AGCGAACTGAAGCACGAGGCTCTCG
>probe:Drosophila_2:1631220_at:138:321; Interrogation_Position=583; Antisense; GCCCCGGAAGTGAGTGCCATCAAGT
>probe:Drosophila_2:1631220_at:681:31; Interrogation_Position=601; Antisense; ATCAAGTCGCACAACGTCTCGTTCA
>probe:Drosophila_2:1631220_at:582:261; Interrogation_Position=691; Antisense; CACCAGCTGCGCATGTGGACCGTGG
>probe:Drosophila_2:1631220_at:86:611; Interrogation_Position=744; Antisense; TGACCTCCAGGAGATTGTCCACGAG
>probe:Drosophila_2:1631220_at:448:419; Interrogation_Position=766; Antisense; GAGCAGGTGAGTCGTGTCTATTCTA
>probe:Drosophila_2:1631220_at:696:497; Interrogation_Position=781; Antisense; GTCTATTCTATGTCTATTCAGCTTA

Paste this into a BLAST search page for me
GAAGCAGTAAGATGTCCTCACCACTTCAGCAGCACAATATGCCAGGGCCTAGGGCCTGCCAGATTTGCACAAACAAGCTGCAGTCAGTCTTCCACGTGGAAGTGCCCCACTATGAGCTCGTGCAGGCCGCCCCACCACGTGAAAAAGGATGGATCTCAGCAAGAACGCCTACTACAGCGAACTGAAGCACGAGGCTCTCGGCCCCGGAAGTGAGTGCCATCAAGTATCAAGTCGCACAACGTCTCGTTCACACCAGCTGCGCATGTGGACCGTGGTGACCTCCAGGAGATTGTCCACGAGGAGCAGGTGAGTCGTGTCTATTCTAGTCTATTCTATGTCTATTCAGCTTA

Full Affymetrix probeset data:

Annotations for 1631220_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720