FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631222_at:

>probe:Drosophila_2:1631222_at:682:665; Interrogation_Position=3525; Antisense; TACAAAGGACATCGGCTTACGCAAG
>probe:Drosophila_2:1631222_at:192:707; Interrogation_Position=3541; Antisense; TTACGCAAGCAAACCGCAACCCGAA
>probe:Drosophila_2:1631222_at:93:235; Interrogation_Position=3570; Antisense; AATCCAATCCCCAATCCAATTGAAT
>probe:Drosophila_2:1631222_at:174:91; Interrogation_Position=3648; Antisense; AGTAGTATAAAGTCCCAAGAGCAGA
>probe:Drosophila_2:1631222_at:619:351; Interrogation_Position=3668; Antisense; GCAGACTTGTGCAGTTTTAGGCCAA
>probe:Drosophila_2:1631222_at:10:681; Interrogation_Position=3685; Antisense; TAGGCCAAATTTTATCACATTGATG
>probe:Drosophila_2:1631222_at:367:651; Interrogation_Position=3699; Antisense; TCACATTGATGTGCCATTCCAAAAA
>probe:Drosophila_2:1631222_at:314:357; Interrogation_Position=3733; Antisense; GCAAACCAGTTCATACACCTAACAA
>probe:Drosophila_2:1631222_at:678:237; Interrogation_Position=3803; Antisense; AATCTATGTGTGACCCACAGTCTAA
>probe:Drosophila_2:1631222_at:205:163; Interrogation_Position=3829; Antisense; AAATTCTGTAGAGCTCGTAAGTGAT
>probe:Drosophila_2:1631222_at:634:51; Interrogation_Position=3875; Antisense; ATGCGTTGGCTAAACTTGTATACTG
>probe:Drosophila_2:1631222_at:371:391; Interrogation_Position=3899; Antisense; GAAACGAATCTGATTTCAACCATTT
>probe:Drosophila_2:1631222_at:458:481; Interrogation_Position=3945; Antisense; GTATTTAGCCAGTTCAGACTCGAAA
>probe:Drosophila_2:1631222_at:678:455; Interrogation_Position=3975; Antisense; GATAACTCTATATGGTAGCACTCAA

Paste this into a BLAST search page for me
TACAAAGGACATCGGCTTACGCAAGTTACGCAAGCAAACCGCAACCCGAAAATCCAATCCCCAATCCAATTGAATAGTAGTATAAAGTCCCAAGAGCAGAGCAGACTTGTGCAGTTTTAGGCCAATAGGCCAAATTTTATCACATTGATGTCACATTGATGTGCCATTCCAAAAAGCAAACCAGTTCATACACCTAACAAAATCTATGTGTGACCCACAGTCTAAAAATTCTGTAGAGCTCGTAAGTGATATGCGTTGGCTAAACTTGTATACTGGAAACGAATCTGATTTCAACCATTTGTATTTAGCCAGTTCAGACTCGAAAGATAACTCTATATGGTAGCACTCAA

Full Affymetrix probeset data:

Annotations for 1631222_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720