Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631223_at:

>probe:Drosophila_2:1631223_at:512:547; Interrogation_Position=1073; Antisense; GGATGAGTTCGACCGGCTTTGCAAA
>probe:Drosophila_2:1631223_at:211:387; Interrogation_Position=1113; Antisense; GAAAAGCCACATCAGCCGATTTTGT
>probe:Drosophila_2:1631223_at:15:305; Interrogation_Position=1128; Antisense; CCGATTTTGTACTTGGCAGGGATGC
>probe:Drosophila_2:1631223_at:12:269; Interrogation_Position=1144; Antisense; CAGGGATGCTGCACTCCGTGGAAGA
>probe:Drosophila_2:1631223_at:1:561; Interrogation_Position=1175; Antisense; GGAAATGCACAAACGCCTGAAGCTA
>probe:Drosophila_2:1631223_at:624:377; Interrogation_Position=1193; Antisense; GAAGCTATCCGCCTACGAACGAGAC
>probe:Drosophila_2:1631223_at:356:423; Interrogation_Position=1213; Antisense; GAGACCTGGCTAGGTTCATTACCCA
>probe:Drosophila_2:1631223_at:658:109; Interrogation_Position=1246; Antisense; AGAAGGTTGGCTCACAGTACACGAC
>probe:Drosophila_2:1631223_at:438:137; Interrogation_Position=1266; Antisense; ACGACCCTGCGTGACTATCAGAAGT
>probe:Drosophila_2:1631223_at:467:393; Interrogation_Position=1337; Antisense; GAAATACTCTGGCAAACTGGAACTT
>probe:Drosophila_2:1631223_at:305:203; Interrogation_Position=1365; Antisense; AACCAGCTCAAGTCGTGGGTCAAGC
>probe:Drosophila_2:1631223_at:349:167; Interrogation_Position=1409; Antisense; AAATGCTTTGGCTCAGCGTGGTCTG
>probe:Drosophila_2:1631223_at:368:459; Interrogation_Position=1491; Antisense; GATTTTCAGCTAACACACGACGATT
>probe:Drosophila_2:1631223_at:542:95; Interrogation_Position=1546; Antisense; AGATACCAAGCGCTCCTGGTAAAGT

Paste this into a BLAST search page for me
GGATGAGTTCGACCGGCTTTGCAAAGAAAAGCCACATCAGCCGATTTTGTCCGATTTTGTACTTGGCAGGGATGCCAGGGATGCTGCACTCCGTGGAAGAGGAAATGCACAAACGCCTGAAGCTAGAAGCTATCCGCCTACGAACGAGACGAGACCTGGCTAGGTTCATTACCCAAGAAGGTTGGCTCACAGTACACGACACGACCCTGCGTGACTATCAGAAGTGAAATACTCTGGCAAACTGGAACTTAACCAGCTCAAGTCGTGGGTCAAGCAAATGCTTTGGCTCAGCGTGGTCTGGATTTTCAGCTAACACACGACGATTAGATACCAAGCGCTCCTGGTAAAGT

Full Affymetrix probeset data:

Annotations for 1631223_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime