FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631224_at:

>probe:Drosophila_2:1631224_at:473:417; Interrogation_Position=1123; Antisense; GAGCGTTGGCTTGAGTTGGCACCAT
>probe:Drosophila_2:1631224_at:688:687; Interrogation_Position=1147; Antisense; TATTTACTATTCTACCGGGACACGA
>probe:Drosophila_2:1631224_at:660:541; Interrogation_Position=1182; Antisense; GGATATGGACGACTACTCGCGGAAA
>probe:Drosophila_2:1631224_at:255:121; Interrogation_Position=1265; Antisense; AGCGGCTATTCACGGATATTCTCTT
>probe:Drosophila_2:1631224_at:305:77; Interrogation_Position=1304; Antisense; AGGAGTCATTGGATCTTCATCGCAA
>probe:Drosophila_2:1631224_at:67:173; Interrogation_Position=1335; Antisense; AAAGAGTCCTGCCTACGCTTATGTC
>probe:Drosophila_2:1631224_at:290:61; Interrogation_Position=1355; Antisense; ATGTCTATGACAATCCAGCCGAAAA
>probe:Drosophila_2:1631224_at:625:169; Interrogation_Position=1378; Antisense; AAAGGAATCGCACAGGTCCTGGCCA
>probe:Drosophila_2:1631224_at:489:73; Interrogation_Position=1391; Antisense; AGGTCCTGGCCAATCGAACCGATTA
>probe:Drosophila_2:1631224_at:352:457; Interrogation_Position=1417; Antisense; GATTTTGGAACTGTACACGGTGACG
>probe:Drosophila_2:1631224_at:276:259; Interrogation_Position=1432; Antisense; CACGGTGACGACTACTTTTTGATAT
>probe:Drosophila_2:1631224_at:140:25; Interrogation_Position=1523; Antisense; ATATGCTGGCAGATTTTGCTTCGAG
>probe:Drosophila_2:1631224_at:438:341; Interrogation_Position=1621; Antisense; GCTATTTATATTGATGGCTGCCAGA
>probe:Drosophila_2:1631224_at:129:241; Interrogation_Position=1645; Antisense; AATAGGCAGCATGTGGAATTTCCGT

Paste this into a BLAST search page for me
GAGCGTTGGCTTGAGTTGGCACCATTATTTACTATTCTACCGGGACACGAGGATATGGACGACTACTCGCGGAAAAGCGGCTATTCACGGATATTCTCTTAGGAGTCATTGGATCTTCATCGCAAAAAGAGTCCTGCCTACGCTTATGTCATGTCTATGACAATCCAGCCGAAAAAAAGGAATCGCACAGGTCCTGGCCAAGGTCCTGGCCAATCGAACCGATTAGATTTTGGAACTGTACACGGTGACGCACGGTGACGACTACTTTTTGATATATATGCTGGCAGATTTTGCTTCGAGGCTATTTATATTGATGGCTGCCAGAAATAGGCAGCATGTGGAATTTCCGT

Full Affymetrix probeset data:

Annotations for 1631224_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720