FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631225_at:

>probe:Drosophila_2:1631225_at:118:729; Interrogation_Position=455; Antisense; TTGGCACAGCCGGATAGTCTGCGAT
>probe:Drosophila_2:1631225_at:231:25; Interrogation_Position=468; Antisense; ATAGTCTGCGATCCAAGCCGTACTT
>probe:Drosophila_2:1631225_at:60:125; Interrogation_Position=483; Antisense; AGCCGTACTTTGATTTTCTGAGCAC
>probe:Drosophila_2:1631225_at:403:715; Interrogation_Position=498; Antisense; TTCTGAGCACACTGTATGCCCACGA
>probe:Drosophila_2:1631225_at:283:455; Interrogation_Position=521; Antisense; GATACGGCCAAGTCGAATCTGTTTC
>probe:Drosophila_2:1631225_at:711:37; Interrogation_Position=537; Antisense; ATCTGTTTCGGCCATATTCGGTGCG
>probe:Drosophila_2:1631225_at:728:441; Interrogation_Position=578; Antisense; GATGTCCAGAAGCTGAGTCGTCCGC
>probe:Drosophila_2:1631225_at:71:101; Interrogation_Position=684; Antisense; AGAGGCGTCACGATCTGAACCGTCT
>probe:Drosophila_2:1631225_at:45:515; Interrogation_Position=716; Antisense; GTGTAGTACACTCCAATCGAATCCA
>probe:Drosophila_2:1631225_at:127:629; Interrogation_Position=757; Antisense; TCCGGTTTGGTTTGGCCTTCTACAG
>probe:Drosophila_2:1631225_at:287:713; Interrogation_Position=774; Antisense; TTCTACAGGGTCCTCTAGCACTTAG
>probe:Drosophila_2:1631225_at:206:675; Interrogation_Position=789; Antisense; TAGCACTTAGCCACTTAGCCACTTT
>probe:Drosophila_2:1631225_at:668:693; Interrogation_Position=811; Antisense; TTTCGATGCGTCCTAGTTCTAAGTC
>probe:Drosophila_2:1631225_at:287:703; Interrogation_Position=986; Antisense; TTATGCCACTTGTTATCGCGACGTT

Paste this into a BLAST search page for me
TTGGCACAGCCGGATAGTCTGCGATATAGTCTGCGATCCAAGCCGTACTTAGCCGTACTTTGATTTTCTGAGCACTTCTGAGCACACTGTATGCCCACGAGATACGGCCAAGTCGAATCTGTTTCATCTGTTTCGGCCATATTCGGTGCGGATGTCCAGAAGCTGAGTCGTCCGCAGAGGCGTCACGATCTGAACCGTCTGTGTAGTACACTCCAATCGAATCCATCCGGTTTGGTTTGGCCTTCTACAGTTCTACAGGGTCCTCTAGCACTTAGTAGCACTTAGCCACTTAGCCACTTTTTTCGATGCGTCCTAGTTCTAAGTCTTATGCCACTTGTTATCGCGACGTT

Full Affymetrix probeset data:

Annotations for 1631225_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720