FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631226_at:

>probe:Drosophila_2:1631226_at:150:39; Interrogation_Position=1067; Antisense; ATCTACCTGGAGTACAATCCGCTGG
>probe:Drosophila_2:1631226_at:127:581; Interrogation_Position=1089; Antisense; TGGCCAAGGATGTTCGCTACCGCTC
>probe:Drosophila_2:1631226_at:244:375; Interrogation_Position=1144; Antisense; GAAGATTGATGCCACCCTGTGCAAG
>probe:Drosophila_2:1631226_at:75:535; Interrogation_Position=1168; Antisense; GGTGCCCGGTACCTAGATGGAACCA
>probe:Drosophila_2:1631226_at:122:343; Interrogation_Position=1183; Antisense; GATGGAACCACTGTAAACCCCTTGA
>probe:Drosophila_2:1631226_at:442:393; Interrogation_Position=1206; Antisense; GAAAGACTAATCCACGGCGTTGCGC
>probe:Drosophila_2:1631226_at:531:327; Interrogation_Position=1222; Antisense; GCGTTGCGCCACTACATTTATATCG
>probe:Drosophila_2:1631226_at:91:137; Interrogation_Position=721; Antisense; ACGACAGCTCTTCCTGGGCAAAAAT
>probe:Drosophila_2:1631226_at:364:551; Interrogation_Position=787; Antisense; GGAGATACTCAGTCTACAGGCCAAT
>probe:Drosophila_2:1631226_at:368:379; Interrogation_Position=829; Antisense; GAACCTTGAAAAGCTTGCCAACCTC
>probe:Drosophila_2:1631226_at:668:391; Interrogation_Position=884; Antisense; GAAACCATTGAAAACCTCTCGGAGA
>probe:Drosophila_2:1631226_at:561:587; Interrogation_Position=918; Antisense; TGGAGACCCTCGACTTGGCCAAGAA
>probe:Drosophila_2:1631226_at:563:379; Interrogation_Position=940; Antisense; GAACCGGTTGAAGGGCATTGCCAAT
>probe:Drosophila_2:1631226_at:672:337; Interrogation_Position=982; Antisense; GCTCGAGGAGCTGTGGCTGAACCAC

Paste this into a BLAST search page for me
ATCTACCTGGAGTACAATCCGCTGGTGGCCAAGGATGTTCGCTACCGCTCGAAGATTGATGCCACCCTGTGCAAGGGTGCCCGGTACCTAGATGGAACCAGATGGAACCACTGTAAACCCCTTGAGAAAGACTAATCCACGGCGTTGCGCGCGTTGCGCCACTACATTTATATCGACGACAGCTCTTCCTGGGCAAAAATGGAGATACTCAGTCTACAGGCCAATGAACCTTGAAAAGCTTGCCAACCTCGAAACCATTGAAAACCTCTCGGAGATGGAGACCCTCGACTTGGCCAAGAAGAACCGGTTGAAGGGCATTGCCAATGCTCGAGGAGCTGTGGCTGAACCAC

Full Affymetrix probeset data:

Annotations for 1631226_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720