FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631227_at:

>probe:Drosophila_2:1631227_at:151:531; Interrogation_Position=303; Antisense; GGGTCAGCCCATTGTGTTACCAAAA
>probe:Drosophila_2:1631227_at:86:171; Interrogation_Position=375; Antisense; AAAGCCCTGCAAGAACGTATCCAAG
>probe:Drosophila_2:1631227_at:102:29; Interrogation_Position=426; Antisense; ATACTGCCTGGCTTTGGATCTAACT
>probe:Drosophila_2:1631227_at:680:85; Interrogation_Position=455; Antisense; AGTGCAATTTGGGACCAGCTCGGGC
>probe:Drosophila_2:1631227_at:690:541; Interrogation_Position=508; Antisense; GGATTTGATACTTCTACGCCCGTGT
>probe:Drosophila_2:1631227_at:660:573; Interrogation_Position=530; Antisense; TGTCCCAGTTTATACCCATCGAAAA
>probe:Drosophila_2:1631227_at:167:583; Interrogation_Position=583; Antisense; TGGCTCACCGTCAATGGAGACCTTA
>probe:Drosophila_2:1631227_at:539:531; Interrogation_Position=616; Antisense; GGGTGCACTGCAGACTTAATATTCA
>probe:Drosophila_2:1631227_at:393:241; Interrogation_Position=633; Antisense; AATATTCAAGGTGCCCGACATCATT
>probe:Drosophila_2:1631227_at:581:151; Interrogation_Position=650; Antisense; ACATCATTTCCTACGTGTCCAAGTA
>probe:Drosophila_2:1631227_at:184:219; Interrogation_Position=670; Antisense; AAGTACATGACCCTGGAGGCCAACG
>probe:Drosophila_2:1631227_at:337:199; Interrogation_Position=691; Antisense; AACGATCTGATCCTTACCGGAACGC
>probe:Drosophila_2:1631227_at:225:713; Interrogation_Position=752; Antisense; TTCAGTGTGGAATGGCCGATCTCGC
>probe:Drosophila_2:1631227_at:121:451; Interrogation_Position=769; Antisense; GATCTCGCTAAATTGACCTTCCAAG

Paste this into a BLAST search page for me
GGGTCAGCCCATTGTGTTACCAAAAAAAGCCCTGCAAGAACGTATCCAAGATACTGCCTGGCTTTGGATCTAACTAGTGCAATTTGGGACCAGCTCGGGCGGATTTGATACTTCTACGCCCGTGTTGTCCCAGTTTATACCCATCGAAAATGGCTCACCGTCAATGGAGACCTTAGGGTGCACTGCAGACTTAATATTCAAATATTCAAGGTGCCCGACATCATTACATCATTTCCTACGTGTCCAAGTAAAGTACATGACCCTGGAGGCCAACGAACGATCTGATCCTTACCGGAACGCTTCAGTGTGGAATGGCCGATCTCGCGATCTCGCTAAATTGACCTTCCAAG

Full Affymetrix probeset data:

Annotations for 1631227_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720