Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631228_a_at:

>probe:Drosophila_2:1631228_a_at:626:627; Interrogation_Position=169; Antisense; TCACGGTGCCCGGAACCAAGTGGTG
>probe:Drosophila_2:1631228_a_at:40:187; Interrogation_Position=204; Antisense; AACACGGCGGCGAACTTCGAGGATT
>probe:Drosophila_2:1631228_a_at:184:105; Interrogation_Position=244; Antisense; AGACGGACAAGTGCTGTCGTGCCCA
>probe:Drosophila_2:1631228_a_at:336:137; Interrogation_Position=280; Antisense; ACGAGATTATCGAGTCCCACGGAGC
>probe:Drosophila_2:1631228_a_at:702:91; Interrogation_Position=367; Antisense; AGTTTATCAATTGCCTGCAGGCAGT
>probe:Drosophila_2:1631228_a_at:693:9; Interrogation_Position=399; Antisense; ATCACGGCCAAAACTCTGGGTCGTA
>probe:Drosophila_2:1631228_a_at:459:535; Interrogation_Position=417; Antisense; GGTCGTATCTACTATGGCAGCAGGA
>probe:Drosophila_2:1631228_a_at:715:75; Interrogation_Position=438; Antisense; AGGAGCAGGTGCTTTGCCAACGGAC
>probe:Drosophila_2:1631228_a_at:473:113; Interrogation_Position=481; Antisense; AGCAGTACCAGGAGGGCACCTTCCG
>probe:Drosophila_2:1631228_a_at:617:333; Interrogation_Position=511; Antisense; GCTGTATCCGCTACCAGGTGGACAA
>probe:Drosophila_2:1631228_a_at:410:201; Interrogation_Position=540; Antisense; AAGGCCAAGGTCTGGCAGTTCTACG
>probe:Drosophila_2:1631228_a_at:378:93; Interrogation_Position=556; Antisense; AGTTCTACGACATGCCGTTCTTCAC
>probe:Drosophila_2:1631228_a_at:445:329; Interrogation_Position=588; Antisense; GCGTCGGCGGGCTGACATGATATCA
>probe:Drosophila_2:1631228_a_at:149:463; Interrogation_Position=631; Antisense; GATTACATTACCTGATGCGCACATC

Paste this into a BLAST search page for me
TCACGGTGCCCGGAACCAAGTGGTGAACACGGCGGCGAACTTCGAGGATTAGACGGACAAGTGCTGTCGTGCCCAACGAGATTATCGAGTCCCACGGAGCAGTTTATCAATTGCCTGCAGGCAGTATCACGGCCAAAACTCTGGGTCGTAGGTCGTATCTACTATGGCAGCAGGAAGGAGCAGGTGCTTTGCCAACGGACAGCAGTACCAGGAGGGCACCTTCCGGCTGTATCCGCTACCAGGTGGACAAAAGGCCAAGGTCTGGCAGTTCTACGAGTTCTACGACATGCCGTTCTTCACGCGTCGGCGGGCTGACATGATATCAGATTACATTACCTGATGCGCACATC

Full Affymetrix probeset data:

Annotations for 1631228_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime