FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631231_at:

>probe:Drosophila_2:1631231_at:349:409; Interrogation_Position=3331; Antisense; GACGTTGTAGTCATAGCACTTAAGC
>probe:Drosophila_2:1631231_at:125:17; Interrogation_Position=3380; Antisense; ATTTTGTTGCCACTTTATGGAAATT
>probe:Drosophila_2:1631231_at:622:631; Interrogation_Position=3407; Antisense; TCCCTTCACCCCAACTAAATAAGAG
>probe:Drosophila_2:1631231_at:124:391; Interrogation_Position=3434; Antisense; GAAACTGCCATTTAAATATTTGTAG
>probe:Drosophila_2:1631231_at:401:485; Interrogation_Position=3455; Antisense; GTAGACACATGAGAAATCACCGAAA
>probe:Drosophila_2:1631231_at:429:445; Interrogation_Position=3489; Antisense; GATGCGATGTTTGCCAACTGTTGAG
>probe:Drosophila_2:1631231_at:610:311; Interrogation_Position=3501; Antisense; GCCAACTGTTGAGCATTTGTTTTCT
>probe:Drosophila_2:1631231_at:598:115; Interrogation_Position=3512; Antisense; AGCATTTGTTTTCTGCGCATTTAAT
>probe:Drosophila_2:1631231_at:643:431; Interrogation_Position=3538; Antisense; GAGTCCTCAATTTAAATTGGCACTA
>probe:Drosophila_2:1631231_at:409:25; Interrogation_Position=3566; Antisense; ATACGTGAAATTATGTCCAAGCCAG
>probe:Drosophila_2:1631231_at:9:63; Interrogation_Position=3578; Antisense; ATGTCCAAGCCAGATTTGTGTAGCA
>probe:Drosophila_2:1631231_at:706:669; Interrogation_Position=3639; Antisense; TATCGATAGTCGGTGTAACATAGCG
>probe:Drosophila_2:1631231_at:85:493; Interrogation_Position=3653; Antisense; GTAACATAGCGAATGCCCAGCGGCA
>probe:Drosophila_2:1631231_at:579:321; Interrogation_Position=3667; Antisense; GCCCAGCGGCAAGCGAACAATTATA

Paste this into a BLAST search page for me
GACGTTGTAGTCATAGCACTTAAGCATTTTGTTGCCACTTTATGGAAATTTCCCTTCACCCCAACTAAATAAGAGGAAACTGCCATTTAAATATTTGTAGGTAGACACATGAGAAATCACCGAAAGATGCGATGTTTGCCAACTGTTGAGGCCAACTGTTGAGCATTTGTTTTCTAGCATTTGTTTTCTGCGCATTTAATGAGTCCTCAATTTAAATTGGCACTAATACGTGAAATTATGTCCAAGCCAGATGTCCAAGCCAGATTTGTGTAGCATATCGATAGTCGGTGTAACATAGCGGTAACATAGCGAATGCCCAGCGGCAGCCCAGCGGCAAGCGAACAATTATA

Full Affymetrix probeset data:

Annotations for 1631231_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720