Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631233_at:

>probe:Drosophila_2:1631233_at:145:419; Interrogation_Position=415; Antisense; GAGCAGTTCGCTCTGTTGGATCGCT
>probe:Drosophila_2:1631233_at:487:589; Interrogation_Position=431; Antisense; TGGATCGCTGCCAACAAGACGCCAT
>probe:Drosophila_2:1631233_at:257:253; Interrogation_Position=445; Antisense; CAAGACGCCATCTTTCAGGTGGTGT
>probe:Drosophila_2:1631233_at:418:587; Interrogation_Position=469; Antisense; TGGAGCGAGATCTTCGTCCTGCGAG
>probe:Drosophila_2:1631233_at:198:591; Interrogation_Position=502; Antisense; TGGTCTCTGGACATCAGCGCCATGA
>probe:Drosophila_2:1631233_at:124:115; Interrogation_Position=548; Antisense; AGCTCAAACGGCTCATTTGCGAGGC
>probe:Drosophila_2:1631233_at:297:405; Interrogation_Position=589; Antisense; GACGTCCTGGAACTCAACTTTATGG
>probe:Drosophila_2:1631233_at:623:587; Interrogation_Position=611; Antisense; TGGAGTCCCTAATCCTGTGCAGAAA
>probe:Drosophila_2:1631233_at:193:227; Interrogation_Position=649; Antisense; AATGCGGAGTATGCCGTTATCCTGG
>probe:Drosophila_2:1631233_at:647:475; Interrogation_Position=664; Antisense; GTTATCCTGGGAAGCCACTCTAAAG
>probe:Drosophila_2:1631233_at:274:193; Interrogation_Position=730; Antisense; AACTACCTGCGGTTCGGACAACTGC
>probe:Drosophila_2:1631233_at:590:619; Interrogation_Position=752; Antisense; TGCTCCTTGGTCTGAGGCAGCTGTG
>probe:Drosophila_2:1631233_at:585:405; Interrogation_Position=790; Antisense; GACTGCGCGCTTTCTTGTATGTTTC
>probe:Drosophila_2:1631233_at:429:479; Interrogation_Position=810; Antisense; GTTTCGCAGCGTGGTCAGGGACATC

Paste this into a BLAST search page for me
GAGCAGTTCGCTCTGTTGGATCGCTTGGATCGCTGCCAACAAGACGCCATCAAGACGCCATCTTTCAGGTGGTGTTGGAGCGAGATCTTCGTCCTGCGAGTGGTCTCTGGACATCAGCGCCATGAAGCTCAAACGGCTCATTTGCGAGGCGACGTCCTGGAACTCAACTTTATGGTGGAGTCCCTAATCCTGTGCAGAAAAATGCGGAGTATGCCGTTATCCTGGGTTATCCTGGGAAGCCACTCTAAAGAACTACCTGCGGTTCGGACAACTGCTGCTCCTTGGTCTGAGGCAGCTGTGGACTGCGCGCTTTCTTGTATGTTTCGTTTCGCAGCGTGGTCAGGGACATC

Full Affymetrix probeset data:

Annotations for 1631233_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime