Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631234_at:

>probe:Drosophila_2:1631234_at:427:457; Interrogation_Position=1328; Antisense; GTTGTTCCGTTCACGATTAGCCAGG
>probe:Drosophila_2:1631234_at:176:169; Interrogation_Position=1363; Antisense; AAATGGATTGACATTCTTCCTGGTG
>probe:Drosophila_2:1631234_at:28:593; Interrogation_Position=1383; Antisense; TGGTGGCCAACATTCTGACCGGCAT
>probe:Drosophila_2:1631234_at:516:413; Interrogation_Position=1399; Antisense; GACCGGCATGGTGAACATCTTTCTC
>probe:Drosophila_2:1631234_at:13:645; Interrogation_Position=1416; Antisense; TCTTTCTCAGGCCAGAGGATCGCTC
>probe:Drosophila_2:1631234_at:242:101; Interrogation_Position=1429; Antisense; AGAGGATCGCTCTCATTCCGAGTCC
>probe:Drosophila_2:1631234_at:640:629; Interrogation_Position=1445; Antisense; TCCGAGTCCGTCATCATTCTGCTGG
>probe:Drosophila_2:1631234_at:721:11; Interrogation_Position=1460; Antisense; ATTCTGCTGGTCTACATGTTTCTGG
>probe:Drosophila_2:1631234_at:702:579; Interrogation_Position=1482; Antisense; TGGCCACCAAGCTGGTTCACGAATT
>probe:Drosophila_2:1631234_at:172:531; Interrogation_Position=1516; Antisense; GGGTATTCGACTGGCCTGATATCCC
>probe:Drosophila_2:1631234_at:637:297; Interrogation_Position=1542; Antisense; CGCGTGCCCTGTGATTTAACTGAAT
>probe:Drosophila_2:1631234_at:360:563; Interrogation_Position=1621; Antisense; GGAATCTATTACAGTCCACTTCAGT
>probe:Drosophila_2:1631234_at:713:453; Interrogation_Position=1686; Antisense; GATAATGCTGTGTAACTAGACTCGC
>probe:Drosophila_2:1631234_at:647:179; Interrogation_Position=1865; Antisense; AAACATAGTCTGTTCCTTTGACATA

Paste this into a BLAST search page for me
GTTGTTCCGTTCACGATTAGCCAGGAAATGGATTGACATTCTTCCTGGTGTGGTGGCCAACATTCTGACCGGCATGACCGGCATGGTGAACATCTTTCTCTCTTTCTCAGGCCAGAGGATCGCTCAGAGGATCGCTCTCATTCCGAGTCCTCCGAGTCCGTCATCATTCTGCTGGATTCTGCTGGTCTACATGTTTCTGGTGGCCACCAAGCTGGTTCACGAATTGGGTATTCGACTGGCCTGATATCCCCGCGTGCCCTGTGATTTAACTGAATGGAATCTATTACAGTCCACTTCAGTGATAATGCTGTGTAACTAGACTCGCAAACATAGTCTGTTCCTTTGACATA

Full Affymetrix probeset data:

Annotations for 1631234_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime