FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631235_at:

>probe:Drosophila_2:1631235_at:503:105; Interrogation_Position=2262; Antisense; AGAACAAGCATTGGCTCTTCCACGG
>probe:Drosophila_2:1631235_at:366:719; Interrogation_Position=2279; Antisense; TTCCACGGCCCCAATTGGATGAACT
>probe:Drosophila_2:1631235_at:376:589; Interrogation_Position=2294; Antisense; TGGATGAACTCATGGGCCTCGATGG
>probe:Drosophila_2:1631235_at:725:35; Interrogation_Position=2363; Antisense; ATCATCCCAAAATCTCGGTGCGTGT
>probe:Drosophila_2:1631235_at:95:39; Interrogation_Position=2374; Antisense; ATCTCGGTGCGTGTATCTGCAAAGT
>probe:Drosophila_2:1631235_at:29:245; Interrogation_Position=2416; Antisense; AATTTAATGACCGAGCTGATTGCTA
>probe:Drosophila_2:1631235_at:506:203; Interrogation_Position=2450; Antisense; AAGCCAGCGAATCGCATGCCATGGA
>probe:Drosophila_2:1631235_at:296:1; Interrogation_Position=2465; Antisense; ATGCCATGGAAGAGGACCGCGTTCA
>probe:Drosophila_2:1631235_at:360:173; Interrogation_Position=2496; Antisense; AAAGCAGCGATACCGTGACCACATT
>probe:Drosophila_2:1631235_at:379:151; Interrogation_Position=2516; Antisense; ACATTGAGCACCAGCGTCAGCAGGA
>probe:Drosophila_2:1631235_at:149:375; Interrogation_Position=2583; Antisense; GAAGATCCAACGCAAGGAGGTCCTG
>probe:Drosophila_2:1631235_at:633:549; Interrogation_Position=2598; Antisense; GGAGGTCCTGGAACGCACTAGAAAG
>probe:Drosophila_2:1631235_at:254:107; Interrogation_Position=2617; Antisense; AGAAAGATCATTAGCGCCCCTTTGG
>probe:Drosophila_2:1631235_at:279:573; Interrogation_Position=2640; Antisense; GGCGCCTGACGTGCCAAAAAAGTCT

Paste this into a BLAST search page for me
AGAACAAGCATTGGCTCTTCCACGGTTCCACGGCCCCAATTGGATGAACTTGGATGAACTCATGGGCCTCGATGGATCATCCCAAAATCTCGGTGCGTGTATCTCGGTGCGTGTATCTGCAAAGTAATTTAATGACCGAGCTGATTGCTAAAGCCAGCGAATCGCATGCCATGGAATGCCATGGAAGAGGACCGCGTTCAAAAGCAGCGATACCGTGACCACATTACATTGAGCACCAGCGTCAGCAGGAGAAGATCCAACGCAAGGAGGTCCTGGGAGGTCCTGGAACGCACTAGAAAGAGAAAGATCATTAGCGCCCCTTTGGGGCGCCTGACGTGCCAAAAAAGTCT

Full Affymetrix probeset data:

Annotations for 1631235_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720