Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631236_at:

>probe:Drosophila_2:1631236_at:448:673; Interrogation_Position=1033; Antisense; TAGCGGGAAGAGACGCGCCCCGAAA
>probe:Drosophila_2:1631236_at:309:311; Interrogation_Position=1115; Antisense; GCTAAGGTTTTTCACTAGATCCCAA
>probe:Drosophila_2:1631236_at:473:259; Interrogation_Position=582; Antisense; CACGTCGCGCGGATTGGAGGCCACC
>probe:Drosophila_2:1631236_at:155:227; Interrogation_Position=638; Antisense; AAGGCAGCACCTACAGGCCGCGAAT
>probe:Drosophila_2:1631236_at:496:239; Interrogation_Position=660; Antisense; AATAAATCGCCGGACTCGCCGCATG
>probe:Drosophila_2:1631236_at:328:331; Interrogation_Position=686; Antisense; GCTGCTACAACTGCGGCGAATTCGC
>probe:Drosophila_2:1631236_at:648:575; Interrogation_Position=700; Antisense; GGCGAATTCGCCAATCACATTGCCT
>probe:Drosophila_2:1631236_at:70:151; Interrogation_Position=716; Antisense; ACATTGCCTCCGAATGCGCTTTGGG
>probe:Drosophila_2:1631236_at:339:49; Interrogation_Position=729; Antisense; ATGCGCTTTGGGTCCTCAGCCGAAG
>probe:Drosophila_2:1631236_at:129:335; Interrogation_Position=755; Antisense; GCTGTCATCGCTGCCGTGGAGAAGA
>probe:Drosophila_2:1631236_at:234:423; Interrogation_Position=773; Antisense; GAGAAGACCATCTCCATGCCGACTG
>probe:Drosophila_2:1631236_at:78:371; Interrogation_Position=807; Antisense; GAATGTGACCCAAAGCCACAGTAAT
>probe:Drosophila_2:1631236_at:543:437; Interrogation_Position=886; Antisense; GAGGCCACCTAGGAAGTCCTTGGAT
>probe:Drosophila_2:1631236_at:641:305; Interrogation_Position=903; Antisense; CCTTGGATCTTGGACTGGTAGTTGG

Paste this into a BLAST search page for me
TAGCGGGAAGAGACGCGCCCCGAAAGCTAAGGTTTTTCACTAGATCCCAACACGTCGCGCGGATTGGAGGCCACCAAGGCAGCACCTACAGGCCGCGAATAATAAATCGCCGGACTCGCCGCATGGCTGCTACAACTGCGGCGAATTCGCGGCGAATTCGCCAATCACATTGCCTACATTGCCTCCGAATGCGCTTTGGGATGCGCTTTGGGTCCTCAGCCGAAGGCTGTCATCGCTGCCGTGGAGAAGAGAGAAGACCATCTCCATGCCGACTGGAATGTGACCCAAAGCCACAGTAATGAGGCCACCTAGGAAGTCCTTGGATCCTTGGATCTTGGACTGGTAGTTGG

Full Affymetrix probeset data:

Annotations for 1631236_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime