FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631238_at:

>probe:Drosophila_2:1631238_at:621:225; Interrogation_Position=1579; Antisense; AATGGCTCGGAAGACTACGGCTACG
>probe:Drosophila_2:1631238_at:353:669; Interrogation_Position=1594; Antisense; TACGGCTACGATGCCATGGGCGATG
>probe:Drosophila_2:1631238_at:148:639; Interrogation_Position=1626; Antisense; TCGGCTGGTCGAGAAGGGCATTATT
>probe:Drosophila_2:1631238_at:339:5; Interrogation_Position=1648; Antisense; ATTGATCCCACAAAGGTGCTGCGGA
>probe:Drosophila_2:1631238_at:408:141; Interrogation_Position=1681; Antisense; ACGGATGCAGCTGGAGTGGCCTCTC
>probe:Drosophila_2:1631238_at:399:433; Interrogation_Position=1720; Antisense; GAGGTGGTTATCACCGACTCCCGGA
>probe:Drosophila_2:1631238_at:298:405; Interrogation_Position=1735; Antisense; GACTCCCGGAACGATGATCTTTTGT
>probe:Drosophila_2:1631238_at:610:443; Interrogation_Position=1747; Antisense; GATGATCTTTTGTCCAAGTTGTCAG
>probe:Drosophila_2:1631238_at:400:369; Interrogation_Position=1937; Antisense; GAATGAGCGCTTCTGCCAGCAATGA
>probe:Drosophila_2:1631238_at:54:409; Interrogation_Position=1960; Antisense; GACGGTCCCACTGCCGAGGAGATGA
>probe:Drosophila_2:1631238_at:639:167; Interrogation_Position=1988; Antisense; AAATGGTCAAGGCTATTCCCGGCAT
>probe:Drosophila_2:1631238_at:469:571; Interrogation_Position=1998; Antisense; GGCTATTCCCGGCATGGAGCAAGTA
>probe:Drosophila_2:1631238_at:90:443; Interrogation_Position=2046; Antisense; GATGATGTAGAACCCGCTTCCGTTA
>probe:Drosophila_2:1631238_at:204:337; Interrogation_Position=2074; Antisense; GCTCCAGCTCAAATCGTTTCTATAG

Paste this into a BLAST search page for me
AATGGCTCGGAAGACTACGGCTACGTACGGCTACGATGCCATGGGCGATGTCGGCTGGTCGAGAAGGGCATTATTATTGATCCCACAAAGGTGCTGCGGAACGGATGCAGCTGGAGTGGCCTCTCGAGGTGGTTATCACCGACTCCCGGAGACTCCCGGAACGATGATCTTTTGTGATGATCTTTTGTCCAAGTTGTCAGGAATGAGCGCTTCTGCCAGCAATGAGACGGTCCCACTGCCGAGGAGATGAAAATGGTCAAGGCTATTCCCGGCATGGCTATTCCCGGCATGGAGCAAGTAGATGATGTAGAACCCGCTTCCGTTAGCTCCAGCTCAAATCGTTTCTATAG

Full Affymetrix probeset data:

Annotations for 1631238_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720