Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631240_at:

>probe:Drosophila_2:1631240_at:552:79; Interrogation_Position=2163; Antisense; AGGTCCATCTGGATATGATCGCACA
>probe:Drosophila_2:1631240_at:462:153; Interrogation_Position=2185; Antisense; ACACGTAACGCCGTCATTGGGAATA
>probe:Drosophila_2:1631240_at:206:655; Interrogation_Position=2208; Antisense; TAAGGACTTCGATCTGACCTACCTG
>probe:Drosophila_2:1631240_at:221:589; Interrogation_Position=2231; Antisense; TGGAGGAGGCCTACACCACAGAACA
>probe:Drosophila_2:1631240_at:134:157; Interrogation_Position=2253; Antisense; ACACTGGCTTGTTCGCATCTATAGG
>probe:Drosophila_2:1631240_at:655:423; Interrogation_Position=2323; Antisense; GAGAGAACGATTCCTCCAGCAAACT
>probe:Drosophila_2:1631240_at:89:571; Interrogation_Position=2380; Antisense; GGCTACATACGAAACCGACCGGTTG
>probe:Drosophila_2:1631240_at:516:697; Interrogation_Position=2552; Antisense; TTTAATCGCCGCCTCAAATTCAACT
>probe:Drosophila_2:1631240_at:331:161; Interrogation_Position=2567; Antisense; AAATTCAACTTTCACATACTTCCCG
>probe:Drosophila_2:1631240_at:92:405; Interrogation_Position=2591; Antisense; GACTCGTGCGACACAATTTTATCGA
>probe:Drosophila_2:1631240_at:552:469; Interrogation_Position=2616; Antisense; GTTGCTGCTTTCGTAAAATTTCCGG
>probe:Drosophila_2:1631240_at:643:717; Interrogation_Position=2635; Antisense; TTCCGGTTCCTTCGATTTAAATCTG
>probe:Drosophila_2:1631240_at:151:461; Interrogation_Position=2648; Antisense; GATTTAAATCTGTTCGCGGCTCCAC
>probe:Drosophila_2:1631240_at:247:573; Interrogation_Position=2665; Antisense; GGCTCCACCATTCATTGTCTTAAGC

Paste this into a BLAST search page for me
AGGTCCATCTGGATATGATCGCACAACACGTAACGCCGTCATTGGGAATATAAGGACTTCGATCTGACCTACCTGTGGAGGAGGCCTACACCACAGAACAACACTGGCTTGTTCGCATCTATAGGGAGAGAACGATTCCTCCAGCAAACTGGCTACATACGAAACCGACCGGTTGTTTAATCGCCGCCTCAAATTCAACTAAATTCAACTTTCACATACTTCCCGGACTCGTGCGACACAATTTTATCGAGTTGCTGCTTTCGTAAAATTTCCGGTTCCGGTTCCTTCGATTTAAATCTGGATTTAAATCTGTTCGCGGCTCCACGGCTCCACCATTCATTGTCTTAAGC

Full Affymetrix probeset data:

Annotations for 1631240_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime