FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631242_at:

>probe:Drosophila_2:1631242_at:728:9; Interrogation_Position=3343; Antisense; ATTAATGTCGGAAAGTTCAGTCAAT
>probe:Drosophila_2:1631242_at:140:459; Interrogation_Position=3378; Antisense; GATATTTTATAAGGCGGTTCCGTAT
>probe:Drosophila_2:1631242_at:526:377; Interrogation_Position=3534; Antisense; GAAGCGTACCAGACTAATGAACATG
>probe:Drosophila_2:1631242_at:527:55; Interrogation_Position=3550; Antisense; ATGAACATGATCAGGCCTCAGAAGT
>probe:Drosophila_2:1631242_at:227:101; Interrogation_Position=3586; Antisense; AGAGCTAGACTTTTGGGTCCAAGCA
>probe:Drosophila_2:1631242_at:294:531; Interrogation_Position=3600; Antisense; GGGTCCAAGCAGTTACAAAGCCAAC
>probe:Drosophila_2:1631242_at:213:311; Interrogation_Position=3620; Antisense; CCAACTCAAGGATGGCTGATGGAAT
>probe:Drosophila_2:1631242_at:249:333; Interrogation_Position=3634; Antisense; GCTGATGGAATTAAACCGTTTTTGT
>probe:Drosophila_2:1631242_at:329:673; Interrogation_Position=3662; Antisense; TACCCTTTTCTTTTGTGATGCTTCG
>probe:Drosophila_2:1631242_at:542:511; Interrogation_Position=3676; Antisense; GTGATGCTTCGACTTAGCTTGCGCA
>probe:Drosophila_2:1631242_at:654:275; Interrogation_Position=3682; Antisense; CTTCGACTTAGCTTGCGCATTTAAC
>probe:Drosophila_2:1631242_at:507:323; Interrogation_Position=3696; Antisense; GCGCATTTAACAATTCCATTTACGA
>probe:Drosophila_2:1631242_at:235:671; Interrogation_Position=3716; Antisense; TACGAACCAGGAACATTTATGCATT
>probe:Drosophila_2:1631242_at:171:83; Interrogation_Position=3784; Antisense; AGTGAAGCTCTGTAAATCTTTAAGC

Paste this into a BLAST search page for me
ATTAATGTCGGAAAGTTCAGTCAATGATATTTTATAAGGCGGTTCCGTATGAAGCGTACCAGACTAATGAACATGATGAACATGATCAGGCCTCAGAAGTAGAGCTAGACTTTTGGGTCCAAGCAGGGTCCAAGCAGTTACAAAGCCAACCCAACTCAAGGATGGCTGATGGAATGCTGATGGAATTAAACCGTTTTTGTTACCCTTTTCTTTTGTGATGCTTCGGTGATGCTTCGACTTAGCTTGCGCACTTCGACTTAGCTTGCGCATTTAACGCGCATTTAACAATTCCATTTACGATACGAACCAGGAACATTTATGCATTAGTGAAGCTCTGTAAATCTTTAAGC

Full Affymetrix probeset data:

Annotations for 1631242_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720