Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631244_a_at:

>probe:Drosophila_2:1631244_a_at:155:67; Interrogation_Position=1054; Antisense; AGGCGCCCGAAGAGCTATGGGTTAC
>probe:Drosophila_2:1631244_a_at:141:79; Interrogation_Position=1069; Antisense; TATGGGTTACCGTGGTCGCGCCAAT
>probe:Drosophila_2:1631244_a_at:727:245; Interrogation_Position=1090; Antisense; CAATTACTACGCTCCTTACTGATTA
>probe:Drosophila_2:1631244_a_at:380:133; Interrogation_Position=1098; Antisense; ACGCTCCTTACTGATTATTGTTTTA
>probe:Drosophila_2:1631244_a_at:111:29; Interrogation_Position=815; Antisense; ATACTCTGCAACAAGGCTGACGGGC
>probe:Drosophila_2:1631244_a_at:551:1; Interrogation_Position=828; Antisense; AGGCTGACGGGCACCCCAAGGGATT
>probe:Drosophila_2:1631244_a_at:99:355; Interrogation_Position=838; Antisense; GCACCCCAAGGGATTCGCATACATT
>probe:Drosophila_2:1631244_a_at:533:717; Interrogation_Position=851; Antisense; TTCGCATACATTGAGTTTGGTTCCA
>probe:Drosophila_2:1631244_a_at:659:429; Interrogation_Position=878; Antisense; GAGTTTGTCGAGACGGCATTGGCCA
>probe:Drosophila_2:1631244_a_at:628:343; Interrogation_Position=893; Antisense; GCATTGGCCATGAACGAAACCCTCT
>probe:Drosophila_2:1631244_a_at:460:307; Interrogation_Position=900; Antisense; CCATGAACGAAACCCTCTTCCGAGG
>probe:Drosophila_2:1631244_a_at:566:617; Interrogation_Position=915; Antisense; TCTTCCGAGGGCGTCAAATAAAGGT
>probe:Drosophila_2:1631244_a_at:408:79; Interrogation_Position=936; Antisense; AGGTAATGTCGAAGCGCACAAACCG
>probe:Drosophila_2:1631244_a_at:565:175; Interrogation_Position=979; Antisense; AAACCGTTTCGCACGCGGCAGCTTC

Paste this into a BLAST search page for me
AGGCGCCCGAAGAGCTATGGGTTACTATGGGTTACCGTGGTCGCGCCAATCAATTACTACGCTCCTTACTGATTAACGCTCCTTACTGATTATTGTTTTAATACTCTGCAACAAGGCTGACGGGCAGGCTGACGGGCACCCCAAGGGATTGCACCCCAAGGGATTCGCATACATTTTCGCATACATTGAGTTTGGTTCCAGAGTTTGTCGAGACGGCATTGGCCAGCATTGGCCATGAACGAAACCCTCTCCATGAACGAAACCCTCTTCCGAGGTCTTCCGAGGGCGTCAAATAAAGGTAGGTAATGTCGAAGCGCACAAACCGAAACCGTTTCGCACGCGGCAGCTTC

Full Affymetrix probeset data:

Annotations for 1631244_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime