FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631246_at:

>probe:Drosophila_2:1631246_at:626:505; Interrogation_Position=1008; Antisense; GTCCAATCAAGGCAACCCAGGCGAA
>probe:Drosophila_2:1631246_at:11:269; Interrogation_Position=1025; Antisense; CAGGCGAACGCAGTCCAGTGGACAA
>probe:Drosophila_2:1631246_at:29:71; Interrogation_Position=1049; Antisense; AGGCCATGACGGAGCTGTTCAAGAA
>probe:Drosophila_2:1631246_at:315:75; Interrogation_Position=1145; Antisense; AGGACCAGTTCTTCGGCCAGTGAGG
>probe:Drosophila_2:1631246_at:366:291; Interrogation_Position=1178; Antisense; CGGGACGCCTCCTTGTAAATAGATA
>probe:Drosophila_2:1631246_at:388:21; Interrogation_Position=1232; Antisense; ATATACGTATATAACCCACTCCTCA
>probe:Drosophila_2:1631246_at:686:383; Interrogation_Position=1260; Antisense; GAACTCCTGACTTATGCCTGAACTA
>probe:Drosophila_2:1631246_at:544:259; Interrogation_Position=1318; Antisense; CACCGTGCTTTGAAGTTCTTATCTA
>probe:Drosophila_2:1631246_at:650:77; Interrogation_Position=857; Antisense; AGGATTTCATGCGATTCGGTCGCCC
>probe:Drosophila_2:1631246_at:68:559; Interrogation_Position=882; Antisense; GGACAACTTCATGCGCTTCGGGCGT
>probe:Drosophila_2:1631246_at:544:507; Interrogation_Position=925; Antisense; GTGCGCTCCGGGAAGATGGACTCAA
>probe:Drosophila_2:1631246_at:603:551; Interrogation_Position=942; Antisense; GGACTCAAACTTCATTCGATTCGGT
>probe:Drosophila_2:1631246_at:255:493; Interrogation_Position=965; Antisense; GTAAGAGCTTGAAGCCGGCGGCTCC
>probe:Drosophila_2:1631246_at:590:505; Interrogation_Position=993; Antisense; GTCCAAGCCAGTCAAGTCCAATCAA

Paste this into a BLAST search page for me
GTCCAATCAAGGCAACCCAGGCGAACAGGCGAACGCAGTCCAGTGGACAAAGGCCATGACGGAGCTGTTCAAGAAAGGACCAGTTCTTCGGCCAGTGAGGCGGGACGCCTCCTTGTAAATAGATAATATACGTATATAACCCACTCCTCAGAACTCCTGACTTATGCCTGAACTACACCGTGCTTTGAAGTTCTTATCTAAGGATTTCATGCGATTCGGTCGCCCGGACAACTTCATGCGCTTCGGGCGTGTGCGCTCCGGGAAGATGGACTCAAGGACTCAAACTTCATTCGATTCGGTGTAAGAGCTTGAAGCCGGCGGCTCCGTCCAAGCCAGTCAAGTCCAATCAA

Full Affymetrix probeset data:

Annotations for 1631246_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720