FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631247_at:

>probe:Drosophila_2:1631247_at:594:207; Interrogation_Position=334; Antisense; AAGCTGCCCGAAACCATTGTCTATA
>probe:Drosophila_2:1631247_at:282:175; Interrogation_Position=344; Antisense; AAACCATTGTCTATATACCCGGCAC
>probe:Drosophila_2:1631247_at:69:651; Interrogation_Position=359; Antisense; TACCCGGCACTGATTGGCGTTTTAA
>probe:Drosophila_2:1631247_at:371:477; Interrogation_Position=377; Antisense; GTTTTAAGGCTCAGACTTTGCCCAA
>probe:Drosophila_2:1631247_at:192:403; Interrogation_Position=390; Antisense; GACTTTGCCCAAACCCAAATGGAGA
>probe:Drosophila_2:1631247_at:203:117; Interrogation_Position=451; Antisense; AGCTATGCTAATCCTTATAAGTGGC
>probe:Drosophila_2:1631247_at:7:85; Interrogation_Position=604; Antisense; AGTGGAGCATGGCAATCGCAACATT
>probe:Drosophila_2:1631247_at:213:45; Interrogation_Position=638; Antisense; ATCGCGATCGCAGATCACTGTTTGA
>probe:Drosophila_2:1631247_at:301:33; Interrogation_Position=651; Antisense; ATCACTGTTTGATCGGTTCACCAAG
>probe:Drosophila_2:1631247_at:375:541; Interrogation_Position=665; Antisense; GGTTCACCAAGCTCAGTTCATTGAT
>probe:Drosophila_2:1631247_at:180:725; Interrogation_Position=708; Antisense; TTGCATTTTGCGCAGCATCTGTGAT
>probe:Drosophila_2:1631247_at:653:213; Interrogation_Position=736; Antisense; AAGAGATTACTGCTGCCACCTGGTT
>probe:Drosophila_2:1631247_at:427:311; Interrogation_Position=750; Antisense; GCCACCTGGTTATTCCATGTTGCAG
>probe:Drosophila_2:1631247_at:595:73; Interrogation_Position=773; Antisense; AGGACATGTTGCGAGTGGTTTTCAC

Paste this into a BLAST search page for me
AAGCTGCCCGAAACCATTGTCTATAAAACCATTGTCTATATACCCGGCACTACCCGGCACTGATTGGCGTTTTAAGTTTTAAGGCTCAGACTTTGCCCAAGACTTTGCCCAAACCCAAATGGAGAAGCTATGCTAATCCTTATAAGTGGCAGTGGAGCATGGCAATCGCAACATTATCGCGATCGCAGATCACTGTTTGAATCACTGTTTGATCGGTTCACCAAGGGTTCACCAAGCTCAGTTCATTGATTTGCATTTTGCGCAGCATCTGTGATAAGAGATTACTGCTGCCACCTGGTTGCCACCTGGTTATTCCATGTTGCAGAGGACATGTTGCGAGTGGTTTTCAC

Full Affymetrix probeset data:

Annotations for 1631247_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720