Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631248_at:

>probe:Drosophila_2:1631248_at:618:363; Interrogation_Position=2655; Antisense; GAATATGCCGGGTAACCAGTTGTTG
>probe:Drosophila_2:1631248_at:603:695; Interrogation_Position=2688; Antisense; TTTCGATGCCATGAAACGGTGCAAT
>probe:Drosophila_2:1631248_at:729:495; Interrogation_Position=2706; Antisense; GTGCAATCAGTGCTTCCGGTCGGTA
>probe:Drosophila_2:1631248_at:515:305; Interrogation_Position=2721; Antisense; CCGGTCGGTACTGGAGGAGCATATC
>probe:Drosophila_2:1631248_at:143:439; Interrogation_Position=2785; Antisense; GAGGAACTGCAACCGCTGACTCTGT
>probe:Drosophila_2:1631248_at:211:405; Interrogation_Position=2802; Antisense; GACTCTGTCCCTCGACAAGGAGCTG
>probe:Drosophila_2:1631248_at:593:587; Interrogation_Position=2825; Antisense; TGGATCAAACCGCTCAGAAGCTGAG
>probe:Drosophila_2:1631248_at:624:409; Interrogation_Position=2896; Antisense; GACGAATTCCAAATCAAGGGCACCG
>probe:Drosophila_2:1631248_at:166:543; Interrogation_Position=2925; Antisense; GGATTGGTCCAAGGCGCTGGAAACA
>probe:Drosophila_2:1631248_at:159:285; Interrogation_Position=2974; Antisense; CTGCTCTCCGTCAAGAGTGGCGTAA
>probe:Drosophila_2:1631248_at:258:589; Interrogation_Position=3005; Antisense; TGGATGGACCAATCGAGACGCGTGA
>probe:Drosophila_2:1631248_at:690:263; Interrogation_Position=3085; Antisense; CAGAGACGCAGTCAGGGCAAGTCCC
>probe:Drosophila_2:1631248_at:477:361; Interrogation_Position=3101; Antisense; GCAAGTCCCTGATCTAGAGTTCATA
>probe:Drosophila_2:1631248_at:419:151; Interrogation_Position=3179; Antisense; ACATATTGTTGTAAGCTCCGTTAAA

Paste this into a BLAST search page for me
GAATATGCCGGGTAACCAGTTGTTGTTTCGATGCCATGAAACGGTGCAATGTGCAATCAGTGCTTCCGGTCGGTACCGGTCGGTACTGGAGGAGCATATCGAGGAACTGCAACCGCTGACTCTGTGACTCTGTCCCTCGACAAGGAGCTGTGGATCAAACCGCTCAGAAGCTGAGGACGAATTCCAAATCAAGGGCACCGGGATTGGTCCAAGGCGCTGGAAACACTGCTCTCCGTCAAGAGTGGCGTAATGGATGGACCAATCGAGACGCGTGACAGAGACGCAGTCAGGGCAAGTCCCGCAAGTCCCTGATCTAGAGTTCATAACATATTGTTGTAAGCTCCGTTAAA

Full Affymetrix probeset data:

Annotations for 1631248_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime