FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631249_at:

>probe:Drosophila_2:1631249_at:479:73; Interrogation_Position=1000; Antisense; AGGACAGCAGTTCCGGGAGTCAACC
>probe:Drosophila_2:1631249_at:347:527; Interrogation_Position=1014; Antisense; GGGAGTCAACCTATTGTAGCTGAAT
>probe:Drosophila_2:1631249_at:388:487; Interrogation_Position=1029; Antisense; GTAGCTGAATGTCCAACCAAAGAAC
>probe:Drosophila_2:1631249_at:114:233; Interrogation_Position=1214; Antisense; AATGCTTTGCATTTATACACTAACC
>probe:Drosophila_2:1631249_at:504:343; Interrogation_Position=1254; Antisense; GCTTCTGCAGCAATAACTTTTCTCT
>probe:Drosophila_2:1631249_at:270:251; Interrogation_Position=788; Antisense; CAAGTCGAACATCCAACAGCAGCTG
>probe:Drosophila_2:1631249_at:517:667; Interrogation_Position=819; Antisense; TACTGCAATCGTTTTGGTCCTGGAA
>probe:Drosophila_2:1631249_at:444:691; Interrogation_Position=858; Antisense; TTTGGGTACCACGAGGAAACGCCTG
>probe:Drosophila_2:1631249_at:296:283; Interrogation_Position=880; Antisense; CTGCGCTGCCGGATAACAACATTGG
>probe:Drosophila_2:1631249_at:447:191; Interrogation_Position=897; Antisense; AACATTGGCATTACAGTACTCGCTG
>probe:Drosophila_2:1631249_at:211:489; Interrogation_Position=912; Antisense; GTACTCGCTGATTTTCCGGCAAAAG
>probe:Drosophila_2:1631249_at:91:591; Interrogation_Position=943; Antisense; TGGTTTTTATGCAACTCGCGCATGA
>probe:Drosophila_2:1631249_at:331:295; Interrogation_Position=961; Antisense; CGCATGAAGAATACTCCGCTGAGAC
>probe:Drosophila_2:1631249_at:77:633; Interrogation_Position=975; Antisense; TCCGCTGAGACTCCGACAACGAAAG

Paste this into a BLAST search page for me
AGGACAGCAGTTCCGGGAGTCAACCGGGAGTCAACCTATTGTAGCTGAATGTAGCTGAATGTCCAACCAAAGAACAATGCTTTGCATTTATACACTAACCGCTTCTGCAGCAATAACTTTTCTCTCAAGTCGAACATCCAACAGCAGCTGTACTGCAATCGTTTTGGTCCTGGAATTTGGGTACCACGAGGAAACGCCTGCTGCGCTGCCGGATAACAACATTGGAACATTGGCATTACAGTACTCGCTGGTACTCGCTGATTTTCCGGCAAAAGTGGTTTTTATGCAACTCGCGCATGACGCATGAAGAATACTCCGCTGAGACTCCGCTGAGACTCCGACAACGAAAG

Full Affymetrix probeset data:

Annotations for 1631249_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720