FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631250_at:

>probe:Drosophila_2:1631250_at:7:243; Interrogation_Position=1009; Antisense; AATAGATTGCGCCTTTCCGAGAAGC
>probe:Drosophila_2:1631250_at:320:39; Interrogation_Position=1103; Antisense; ATCTGTCCACCAACTCCAATGGAAG
>probe:Drosophila_2:1631250_at:642:563; Interrogation_Position=1123; Antisense; GGAAGTCCGCAAGCATCTCCAGTGT
>probe:Drosophila_2:1631250_at:447:439; Interrogation_Position=1180; Antisense; GAGGCGTAGAATCAATCACCTATTA
>probe:Drosophila_2:1631250_at:415:703; Interrogation_Position=703; Antisense; TTACCGGAACCTGGAAGCTTCTGCA
>probe:Drosophila_2:1631250_at:693:503; Interrogation_Position=747; Antisense; GTCCGCCTCTTTGGATTATACCAAT
>probe:Drosophila_2:1631250_at:45:173; Interrogation_Position=792; Antisense; AAAGCGTTTCAAGCACGAGTCCTCC
>probe:Drosophila_2:1631250_at:360:643; Interrogation_Position=820; Antisense; TCTCCGAATAGCTCACCACTGAAGA
>probe:Drosophila_2:1631250_at:377:609; Interrogation_Position=839; Antisense; TGAAGAACCACTCTTCGGGAGGTCC
>probe:Drosophila_2:1631250_at:531:427; Interrogation_Position=868; Antisense; GAGATCACGCCGCTGATCAACGATT
>probe:Drosophila_2:1631250_at:252:455; Interrogation_Position=882; Antisense; GATCAACGATTATGCCGATTCCAGC
>probe:Drosophila_2:1631250_at:609:463; Interrogation_Position=898; Antisense; GATTCCAGCAAAAGGATCCGCACTG
>probe:Drosophila_2:1631250_at:544:133; Interrogation_Position=934; Antisense; ACCCAGTTGCTGGAGCTCGAGCGAG
>probe:Drosophila_2:1631250_at:160:279; Interrogation_Position=988; Antisense; CTACGTCGCATCGAAATCGCCAATA

Paste this into a BLAST search page for me
AATAGATTGCGCCTTTCCGAGAAGCATCTGTCCACCAACTCCAATGGAAGGGAAGTCCGCAAGCATCTCCAGTGTGAGGCGTAGAATCAATCACCTATTATTACCGGAACCTGGAAGCTTCTGCAGTCCGCCTCTTTGGATTATACCAATAAAGCGTTTCAAGCACGAGTCCTCCTCTCCGAATAGCTCACCACTGAAGATGAAGAACCACTCTTCGGGAGGTCCGAGATCACGCCGCTGATCAACGATTGATCAACGATTATGCCGATTCCAGCGATTCCAGCAAAAGGATCCGCACTGACCCAGTTGCTGGAGCTCGAGCGAGCTACGTCGCATCGAAATCGCCAATA

Full Affymetrix probeset data:

Annotations for 1631250_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720