FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631251_at:

>probe:Drosophila_2:1631251_at:64:73; Interrogation_Position=140; Antisense; AGGCAAATCCCTCGGATGACGACGA
>probe:Drosophila_2:1631251_at:364:249; Interrogation_Position=258; Antisense; CAAGCATATGAACGTGACCCGCCTG
>probe:Drosophila_2:1631251_at:152:91; Interrogation_Position=299; Antisense; AGTACGGCGCCATCGGCAGAGTTTA
>probe:Drosophila_2:1631251_at:523:351; Interrogation_Position=314; Antisense; GCAGAGTTTACCTACAGCCAGAGAA
>probe:Drosophila_2:1631251_at:402:31; Interrogation_Position=380; Antisense; ATAATATCCACTTCACCGAGGGCTG
>probe:Drosophila_2:1631251_at:46:187; Interrogation_Position=457; Antisense; AACAAGCAGATATCCGGTCGCAAGA
>probe:Drosophila_2:1631251_at:79:503; Interrogation_Position=473; Antisense; GTCGCAAGACGTCCCAATTCTATGA
>probe:Drosophila_2:1631251_at:521:245; Interrogation_Position=488; Antisense; AATTCTATGACTCGCTATGGAGCAT
>probe:Drosophila_2:1631251_at:87:67; Interrogation_Position=504; Antisense; ATGGAGCATGAAGTACCTGCCGCGC
>probe:Drosophila_2:1631251_at:354:319; Interrogation_Position=522; Antisense; GCCGCGCTTTAAGTGGGTCCATCTA
>probe:Drosophila_2:1631251_at:480:531; Interrogation_Position=536; Antisense; GGGTCCATCTAACCGAGCGCATGAA
>probe:Drosophila_2:1631251_at:707:671; Interrogation_Position=562; Antisense; TACGAGCAGGCGGTTCACAAGCAAC
>probe:Drosophila_2:1631251_at:422:209; Interrogation_Position=580; Antisense; AAGCAACGCCTACACACTGAGGTCT
>probe:Drosophila_2:1631251_at:670:51; Interrogation_Position=689; Antisense; ATGCGGAAAAGGCTCTGGCTGCCAA

Paste this into a BLAST search page for me
AGGCAAATCCCTCGGATGACGACGACAAGCATATGAACGTGACCCGCCTGAGTACGGCGCCATCGGCAGAGTTTAGCAGAGTTTACCTACAGCCAGAGAAATAATATCCACTTCACCGAGGGCTGAACAAGCAGATATCCGGTCGCAAGAGTCGCAAGACGTCCCAATTCTATGAAATTCTATGACTCGCTATGGAGCATATGGAGCATGAAGTACCTGCCGCGCGCCGCGCTTTAAGTGGGTCCATCTAGGGTCCATCTAACCGAGCGCATGAATACGAGCAGGCGGTTCACAAGCAACAAGCAACGCCTACACACTGAGGTCTATGCGGAAAAGGCTCTGGCTGCCAA

Full Affymetrix probeset data:

Annotations for 1631251_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720