Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631252_a_at:

>probe:Drosophila_2:1631252_a_at:584:87; Interrogation_Position=220; Antisense; AGTCGCCACAGTCGCCAGTTTCAGC
>probe:Drosophila_2:1631252_a_at:597:257; Interrogation_Position=248; Antisense; CACGCGCAGGCCATCCGGGTGGACT
>probe:Drosophila_2:1631252_a_at:689:525; Interrogation_Position=274; Antisense; GGGCACCAACACAGGACCCATAGCA
>probe:Drosophila_2:1631252_a_at:601:47; Interrogation_Position=348; Antisense; ATCCAGCGCCCGTCTGGGAGGACCA
>probe:Drosophila_2:1631252_a_at:572:73; Interrogation_Position=366; Antisense; AGGACCAGAGCGATGACGTACCCAA
>probe:Drosophila_2:1631252_a_at:456:235; Interrogation_Position=395; Antisense; AATCCCTATGTCTACGTGTTGCCAC
>probe:Drosophila_2:1631252_a_at:707:721; Interrogation_Position=413; Antisense; TTGCCACCGCCTTCGAGACCAAGGA
>probe:Drosophila_2:1631252_a_at:607:221; Interrogation_Position=494; Antisense; AAGGGCAACAACTACGGCCAGCTGG
>probe:Drosophila_2:1631252_a_at:154:581; Interrogation_Position=516; Antisense; TGGCCAGCAATTCCTACAGCGGAGG
>probe:Drosophila_2:1631252_a_at:269:581; Interrogation_Position=561; Antisense; TGGCCGCCCAGTATGTGCCCGGAGT
>probe:Drosophila_2:1631252_a_at:81:519; Interrogation_Position=584; Antisense; GTGGGCATCAAGTATACGGCAATTG
>probe:Drosophila_2:1631252_a_at:290:5; Interrogation_Position=605; Antisense; ATTGTGTCTGATAAGCTGCAGGGCA
>probe:Drosophila_2:1631252_a_at:327:609; Interrogation_Position=664; Antisense; TGAGAAGGCCAAGTACGCTTACCCC
>probe:Drosophila_2:1631252_a_at:594:247; Interrogation_Position=673; Antisense; CAAGTACGCTTACCCCTGGAACTAT

Paste this into a BLAST search page for me
AGTCGCCACAGTCGCCAGTTTCAGCCACGCGCAGGCCATCCGGGTGGACTGGGCACCAACACAGGACCCATAGCAATCCAGCGCCCGTCTGGGAGGACCAAGGACCAGAGCGATGACGTACCCAAAATCCCTATGTCTACGTGTTGCCACTTGCCACCGCCTTCGAGACCAAGGAAAGGGCAACAACTACGGCCAGCTGGTGGCCAGCAATTCCTACAGCGGAGGTGGCCGCCCAGTATGTGCCCGGAGTGTGGGCATCAAGTATACGGCAATTGATTGTGTCTGATAAGCTGCAGGGCATGAGAAGGCCAAGTACGCTTACCCCCAAGTACGCTTACCCCTGGAACTAT

Full Affymetrix probeset data:

Annotations for 1631252_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime