FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631254_at:

>probe:Drosophila_2:1631254_at:487:27; Interrogation_Position=449; Antisense; ATAGCCTTCAGGCAGTTCGTGCACG
>probe:Drosophila_2:1631254_at:487:271; Interrogation_Position=529; Antisense; CATCATAGAGTCATATCCGGGTCCT
>probe:Drosophila_2:1631254_at:612:531; Interrogation_Position=547; Antisense; GGGTCCTCGGATTACAAAACTCTCA
>probe:Drosophila_2:1631254_at:721:177; Interrogation_Position=563; Antisense; AAACTCTCAGACTGGACTATGCCCA
>probe:Drosophila_2:1631254_at:617:393; Interrogation_Position=594; Antisense; GAAAGTGACGCGTTCGTTGTCGCAT
>probe:Drosophila_2:1631254_at:620:619; Interrogation_Position=641; Antisense; TGCTGAATGTCCTCTGTCTGGGCGA
>probe:Drosophila_2:1631254_at:51:525; Interrogation_Position=660; Antisense; GGGCGACTGGATCATCGTTTGCAAT
>probe:Drosophila_2:1631254_at:574:723; Interrogation_Position=698; Antisense; TTGCATATCTGCAGGTATTACCCGC
>probe:Drosophila_2:1631254_at:604:33; Interrogation_Position=772; Antisense; ATCAAAATCTGGAGCATCTGCGCCG
>probe:Drosophila_2:1631254_at:399:641; Interrogation_Position=799; Antisense; TCTCATCGATGTGTGTCCAAGTCCA
>probe:Drosophila_2:1631254_at:615:535; Interrogation_Position=846; Antisense; GGATCTACCAGGACAAACGCCCGTG
>probe:Drosophila_2:1631254_at:18:83; Interrogation_Position=887; Antisense; AGGGATTTGCCCTGCAGATCATGCA
>probe:Drosophila_2:1631254_at:654:37; Interrogation_Position=947; Antisense; ATCTCAATTTGCAGACTCTAGCGGG
>probe:Drosophila_2:1631254_at:266:715; Interrogation_Position=979; Antisense; TTCTTCATTCTGGAGGCCCTGGTTA

Paste this into a BLAST search page for me
ATAGCCTTCAGGCAGTTCGTGCACGCATCATAGAGTCATATCCGGGTCCTGGGTCCTCGGATTACAAAACTCTCAAAACTCTCAGACTGGACTATGCCCAGAAAGTGACGCGTTCGTTGTCGCATTGCTGAATGTCCTCTGTCTGGGCGAGGGCGACTGGATCATCGTTTGCAATTTGCATATCTGCAGGTATTACCCGCATCAAAATCTGGAGCATCTGCGCCGTCTCATCGATGTGTGTCCAAGTCCAGGATCTACCAGGACAAACGCCCGTGAGGGATTTGCCCTGCAGATCATGCAATCTCAATTTGCAGACTCTAGCGGGTTCTTCATTCTGGAGGCCCTGGTTA

Full Affymetrix probeset data:

Annotations for 1631254_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720