FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631256_at:

>probe:Drosophila_2:1631256_at:275:75; Interrogation_Position=3508; Antisense; AGGATATACCTGTGCCGATGATGGC
>probe:Drosophila_2:1631256_at:276:31; Interrogation_Position=3561; Antisense; ATAACAGGTGCTCAGACCATCGGCC
>probe:Drosophila_2:1631256_at:161:639; Interrogation_Position=3580; Antisense; TCGGCCCTGGGATCAACAATATGTC
>probe:Drosophila_2:1631256_at:543:597; Interrogation_Position=3601; Antisense; TGTCACAGATCTCAAAGTCGGTCCC
>probe:Drosophila_2:1631256_at:92:463; Interrogation_Position=3660; Antisense; GATTCACCAGATGGCAACGGCAAAT
>probe:Drosophila_2:1631256_at:479:535; Interrogation_Position=3732; Antisense; GGTGCTTCTGGTGCTACATCTGTAC
>probe:Drosophila_2:1631256_at:715:151; Interrogation_Position=3747; Antisense; ACATCTGTACCCTTTGTGCTAATGG
>probe:Drosophila_2:1631256_at:470:595; Interrogation_Position=3761; Antisense; TGTGCTAATGGTGCGCGGCCACAAG
>probe:Drosophila_2:1631256_at:416:727; Interrogation_Position=3834; Antisense; TTGGCCACCAACCTAAAGCGGCAGG
>probe:Drosophila_2:1631256_at:344:123; Interrogation_Position=3892; Antisense; AGCGCCTTACGCTTAACATAACTGA
>probe:Drosophila_2:1631256_at:321:147; Interrogation_Position=3934; Antisense; ACTACCAGGAGTCGTTGATGCCGCC
>probe:Drosophila_2:1631256_at:112:41; Interrogation_Position=3964; Antisense; ATCGAAACTTCACCCAGAGCTACTA
>probe:Drosophila_2:1631256_at:319:309; Interrogation_Position=4004; Antisense; GCACAAGTTCAAGCACCAAAAGGGT
>probe:Drosophila_2:1631256_at:326:293; Interrogation_Position=4034; Antisense; CGATGCGGACCTCATATTTCACTGA

Paste this into a BLAST search page for me
AGGATATACCTGTGCCGATGATGGCATAACAGGTGCTCAGACCATCGGCCTCGGCCCTGGGATCAACAATATGTCTGTCACAGATCTCAAAGTCGGTCCCGATTCACCAGATGGCAACGGCAAATGGTGCTTCTGGTGCTACATCTGTACACATCTGTACCCTTTGTGCTAATGGTGTGCTAATGGTGCGCGGCCACAAGTTGGCCACCAACCTAAAGCGGCAGGAGCGCCTTACGCTTAACATAACTGAACTACCAGGAGTCGTTGATGCCGCCATCGAAACTTCACCCAGAGCTACTAGCACAAGTTCAAGCACCAAAAGGGTCGATGCGGACCTCATATTTCACTGA

Full Affymetrix probeset data:

Annotations for 1631256_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720