FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631258_at:

>probe:Drosophila_2:1631258_at:352:449; Interrogation_Position=120; Antisense; GATCGCCCGTGGTCTATGGATTGGT
>probe:Drosophila_2:1631258_at:124:651; Interrogation_Position=160; Antisense; TCACCCGTTGAGTATTGCCCGATTG
>probe:Drosophila_2:1631258_at:698:319; Interrogation_Position=176; Antisense; GCCCGATTGCCCTGCGAAAATTTGA
>probe:Drosophila_2:1631258_at:394:237; Interrogation_Position=229; Antisense; AATCGATTCCAGAAGGTGCCCGCCA
>probe:Drosophila_2:1631258_at:670:527; Interrogation_Position=263; Antisense; GGGACTTCCATTTGTCTGAGACCAT
>probe:Drosophila_2:1631258_at:711:375; Interrogation_Position=330; Antisense; GAAGCTCTACCCAAAGACGCTGGAG
>probe:Drosophila_2:1631258_at:95:109; Interrogation_Position=353; Antisense; AGAACCGTGCCCGAGTGGATGAGTT
>probe:Drosophila_2:1631258_at:44:435; Interrogation_Position=382; Antisense; GAGTGGCAACACCTGAACATTCGTC
>probe:Drosophila_2:1631258_at:432:151; Interrogation_Position=398; Antisense; ACATTCGTCTTGCATGTTCCATGTA
>probe:Drosophila_2:1631258_at:202:61; Interrogation_Position=418; Antisense; ATGTACTTTCGAGATGCCTGGCTGT
>probe:Drosophila_2:1631258_at:172:161; Interrogation_Position=512; Antisense; ACAATCTGGGTTTACTGGAGCGCCT
>probe:Drosophila_2:1631258_at:639:161; Interrogation_Position=574; Antisense; ACAATGGCTGATATCCTTGGCTCTT
>probe:Drosophila_2:1631258_at:252:197; Interrogation_Position=59; Antisense; AACGGGAGCAATTGACCACCATGTC
>probe:Drosophila_2:1631258_at:232:269; Interrogation_Position=99; Antisense; CTATTACGATTTGTTGTCCCCGATC

Paste this into a BLAST search page for me
GATCGCCCGTGGTCTATGGATTGGTTCACCCGTTGAGTATTGCCCGATTGGCCCGATTGCCCTGCGAAAATTTGAAATCGATTCCAGAAGGTGCCCGCCAGGGACTTCCATTTGTCTGAGACCATGAAGCTCTACCCAAAGACGCTGGAGAGAACCGTGCCCGAGTGGATGAGTTGAGTGGCAACACCTGAACATTCGTCACATTCGTCTTGCATGTTCCATGTAATGTACTTTCGAGATGCCTGGCTGTACAATCTGGGTTTACTGGAGCGCCTACAATGGCTGATATCCTTGGCTCTTAACGGGAGCAATTGACCACCATGTCCTATTACGATTTGTTGTCCCCGATC

Full Affymetrix probeset data:

Annotations for 1631258_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720