FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631260_at:

>probe:Drosophila_2:1631260_at:150:3; Interrogation_Position=1034; Antisense; ATTGGCATGCCACGTTGATTGTTGA
>probe:Drosophila_2:1631260_at:165:125; Interrogation_Position=1075; Antisense; AGCCTTGCTTACTTTTCTTGCGGAT
>probe:Drosophila_2:1631260_at:534:439; Interrogation_Position=1097; Antisense; GATGGTACAACTTCGAAATGCCTTT
>probe:Drosophila_2:1631260_at:381:681; Interrogation_Position=1140; Antisense; TATGATGATGCATGCCCAAAGGCCG
>probe:Drosophila_2:1631260_at:443:321; Interrogation_Position=1177; Antisense; GCCCTGCTGGTCGATTTGAATCTGA
>probe:Drosophila_2:1631260_at:434:555; Interrogation_Position=1202; Antisense; GGACCTTCATAGACATTGGCCGTGG
>probe:Drosophila_2:1631260_at:573:519; Interrogation_Position=1223; Antisense; GTGGAGCCTACAGCTACTTCAATTT
>probe:Drosophila_2:1631260_at:260:149; Interrogation_Position=1238; Antisense; ACTTCAATTTGCTGCGTAGCTCCCA
>probe:Drosophila_2:1631260_at:262:653; Interrogation_Position=770; Antisense; TAATTGGTCGCCTAACTGCCAGTGA
>probe:Drosophila_2:1631260_at:716:509; Interrogation_Position=791; Antisense; GTGAGTTAACCTTCTGGCAAATGCA
>probe:Drosophila_2:1631260_at:562:91; Interrogation_Position=875; Antisense; AGTATCTGATTTGCGTGCCTGTGAT
>probe:Drosophila_2:1631260_at:705:17; Interrogation_Position=905; Antisense; ATTTCATTATCTTCTCGGTTCTCAT
>probe:Drosophila_2:1631260_at:530:19; Interrogation_Position=928; Antisense; ATTTGCTTTCTCTTTTTTGCCTTGA
>probe:Drosophila_2:1631260_at:278:695; Interrogation_Position=943; Antisense; TTTGCCTTGACAGTTGGCGTTCCAA

Paste this into a BLAST search page for me
ATTGGCATGCCACGTTGATTGTTGAAGCCTTGCTTACTTTTCTTGCGGATGATGGTACAACTTCGAAATGCCTTTTATGATGATGCATGCCCAAAGGCCGGCCCTGCTGGTCGATTTGAATCTGAGGACCTTCATAGACATTGGCCGTGGGTGGAGCCTACAGCTACTTCAATTTACTTCAATTTGCTGCGTAGCTCCCATAATTGGTCGCCTAACTGCCAGTGAGTGAGTTAACCTTCTGGCAAATGCAAGTATCTGATTTGCGTGCCTGTGATATTTCATTATCTTCTCGGTTCTCATATTTGCTTTCTCTTTTTTGCCTTGATTTGCCTTGACAGTTGGCGTTCCAA

Full Affymetrix probeset data:

Annotations for 1631260_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720