Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631261_at:

>probe:Drosophila_2:1631261_at:686:569; Interrogation_Position=1076; Antisense; GGCTCATACTGCTGCGAAGGGATCA
>probe:Drosophila_2:1631261_at:20:421; Interrogation_Position=1111; Antisense; GAGCACAGACCGCAGACCAATAGTT
>probe:Drosophila_2:1631261_at:479:241; Interrogation_Position=1129; Antisense; AATAGTTGCTACAAGGTCCTGCTGG
>probe:Drosophila_2:1631261_at:201:577; Interrogation_Position=1152; Antisense; GGCCGAGTCGTATGTGTTCACTGGC
>probe:Drosophila_2:1631261_at:181:583; Interrogation_Position=1178; Antisense; TGGCGTTGATCTTCTGCTGCTTGGC
>probe:Drosophila_2:1631261_at:311:7; Interrogation_Position=1219; Antisense; ATTGAGTTCGCGGAGCTCATCTCAT
>probe:Drosophila_2:1631261_at:528:595; Interrogation_Position=1258; Antisense; TGTGGACCAACATCGAGCTCATTGC
>probe:Drosophila_2:1631261_at:608:683; Interrogation_Position=1288; Antisense; TATCACAATTGCACCTGCTTGGCGG
>probe:Drosophila_2:1631261_at:237:295; Interrogation_Position=1341; Antisense; CGAGGCTCCAATGGCATTTGCAGTT
>probe:Drosophila_2:1631261_at:83:199; Interrogation_Position=1387; Antisense; AACGATGGTTGTGCCGAGCTTCGGA
>probe:Drosophila_2:1631261_at:16:371; Interrogation_Position=1414; Antisense; GAATGGAAGTATCTGCTCGCCTTCT
>probe:Drosophila_2:1631261_at:543:67; Interrogation_Position=1441; Antisense; ATGGCGCTCAACACTTTGGGCATTG
>probe:Drosophila_2:1631261_at:359:475; Interrogation_Position=1488; Antisense; GTTATTTATTTGTTGCCACCGCAAG
>probe:Drosophila_2:1631261_at:549:121; Interrogation_Position=1511; Antisense; AGCGAGAACACTTTTACACGTCTGT

Paste this into a BLAST search page for me
GGCTCATACTGCTGCGAAGGGATCAGAGCACAGACCGCAGACCAATAGTTAATAGTTGCTACAAGGTCCTGCTGGGGCCGAGTCGTATGTGTTCACTGGCTGGCGTTGATCTTCTGCTGCTTGGCATTGAGTTCGCGGAGCTCATCTCATTGTGGACCAACATCGAGCTCATTGCTATCACAATTGCACCTGCTTGGCGGCGAGGCTCCAATGGCATTTGCAGTTAACGATGGTTGTGCCGAGCTTCGGAGAATGGAAGTATCTGCTCGCCTTCTATGGCGCTCAACACTTTGGGCATTGGTTATTTATTTGTTGCCACCGCAAGAGCGAGAACACTTTTACACGTCTGT

Full Affymetrix probeset data:

Annotations for 1631261_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime