Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631262_at:

>probe:Drosophila_2:1631262_at:79:453; Interrogation_Position=1208; Antisense; GATCATGGCCTATCTGCTGAATCAG
>probe:Drosophila_2:1631262_at:393:409; Interrogation_Position=1235; Antisense; GACGCATCGTGGTCGCGATTACTGG
>probe:Drosophila_2:1631262_at:292:143; Interrogation_Position=1255; Antisense; ACTGGCTGGGCGGTCTCAATCCTGG
>probe:Drosophila_2:1631262_at:385:545; Interrogation_Position=1288; Antisense; GGATCTGGTCCAATTCGGCTAAGCC
>probe:Drosophila_2:1631262_at:628:189; Interrogation_Position=1323; Antisense; AACATGAATCTCACATCCATTGCGA
>probe:Drosophila_2:1631262_at:332:407; Interrogation_Position=1370; Antisense; GACGGCCGCCAATCTGGTGGACAGT
>probe:Drosophila_2:1631262_at:405:335; Interrogation_Position=1468; Antisense; GCTGCCTACGGCTAAGTTACAATGC
>probe:Drosophila_2:1631262_at:118:511; Interrogation_Position=1509; Antisense; GTGTACTACGGACAGGAGTGCACCT
>probe:Drosophila_2:1631262_at:446:567; Interrogation_Position=1537; Antisense; GGCACTACTACATCTGCGAGCACGA
>probe:Drosophila_2:1631262_at:399:455; Interrogation_Position=1583; Antisense; GATCAAGAAGATCACCCGCGAGCTG
>probe:Drosophila_2:1631262_at:338:133; Interrogation_Position=1596; Antisense; ACCCGCGAGCTGAAGCTGTTCGAGT
>probe:Drosophila_2:1631262_at:728:547; Interrogation_Position=1623; Antisense; GGATGGGATGCAACCCATTCCGATC
>probe:Drosophila_2:1631262_at:713:9; Interrogation_Position=1639; Antisense; ATTCCGATCCTCATGTGATACTTCA
>probe:Drosophila_2:1631262_at:729:455; Interrogation_Position=1655; Antisense; GATACTTCAAGTTACCTAGCCATAT

Paste this into a BLAST search page for me
GATCATGGCCTATCTGCTGAATCAGGACGCATCGTGGTCGCGATTACTGGACTGGCTGGGCGGTCTCAATCCTGGGGATCTGGTCCAATTCGGCTAAGCCAACATGAATCTCACATCCATTGCGAGACGGCCGCCAATCTGGTGGACAGTGCTGCCTACGGCTAAGTTACAATGCGTGTACTACGGACAGGAGTGCACCTGGCACTACTACATCTGCGAGCACGAGATCAAGAAGATCACCCGCGAGCTGACCCGCGAGCTGAAGCTGTTCGAGTGGATGGGATGCAACCCATTCCGATCATTCCGATCCTCATGTGATACTTCAGATACTTCAAGTTACCTAGCCATAT

Full Affymetrix probeset data:

Annotations for 1631262_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime