Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631263_at:

>probe:Drosophila_2:1631263_at:477:463; Interrogation_Position=106; Antisense; GATTGGATACCTGCGGTCCGTGGAC
>probe:Drosophila_2:1631263_at:488:63; Interrogation_Position=14; Antisense; ATGGACGACTTAAATCCGCTGGCGG
>probe:Drosophila_2:1631263_at:37:135; Interrogation_Position=154; Antisense; ACGCACCATCGAGCGGATACATGTG
>probe:Drosophila_2:1631263_at:605:595; Interrogation_Position=175; Antisense; TGTGGGCAACGAATACGGCGACATT
>probe:Drosophila_2:1631263_at:623:149; Interrogation_Position=195; Antisense; ACATTCCTCGCGGAGTCTTCATCAT
>probe:Drosophila_2:1631263_at:100:371; Interrogation_Position=229; Antisense; GAATGTGGTGCTACTGGGCGAAATA
>probe:Drosophila_2:1631263_at:347:351; Interrogation_Position=268; Antisense; GCAGAAACTGCCACTCAAAGAGATA
>probe:Drosophila_2:1631263_at:37:429; Interrogation_Position=287; Antisense; GAGATATCCGTCGATGAAATCCTGG
>probe:Drosophila_2:1631263_at:544:55; Interrogation_Position=300; Antisense; ATGAAATCCTGGACGCCCAGCGTAG
>probe:Drosophila_2:1631263_at:69:421; Interrogation_Position=344; Antisense; GAGAAACACCGCCTAGTATCCAAGG
>probe:Drosophila_2:1631263_at:47:71; Interrogation_Position=382; Antisense; AGGCCTGGCCGTAGATGCCAACATA
>probe:Drosophila_2:1631263_at:506:141; Interrogation_Position=41; Antisense; ACGGCTCACCTCCTGGAAGAGGTTG
>probe:Drosophila_2:1631263_at:538:473; Interrogation_Position=79; Antisense; GGTACTTTTGAGAGACGGACGGACT
>probe:Drosophila_2:1631263_at:276:407; Interrogation_Position=96; Antisense; GACGGACTCTGATTGGATACCTGCG

Paste this into a BLAST search page for me
GATTGGATACCTGCGGTCCGTGGACATGGACGACTTAAATCCGCTGGCGGACGCACCATCGAGCGGATACATGTGTGTGGGCAACGAATACGGCGACATTACATTCCTCGCGGAGTCTTCATCATGAATGTGGTGCTACTGGGCGAAATAGCAGAAACTGCCACTCAAAGAGATAGAGATATCCGTCGATGAAATCCTGGATGAAATCCTGGACGCCCAGCGTAGGAGAAACACCGCCTAGTATCCAAGGAGGCCTGGCCGTAGATGCCAACATAACGGCTCACCTCCTGGAAGAGGTTGGGTACTTTTGAGAGACGGACGGACTGACGGACTCTGATTGGATACCTGCG

Full Affymetrix probeset data:

Annotations for 1631263_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime