Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631264_at:

>probe:Drosophila_2:1631264_at:656:375; Interrogation_Position=1302; Antisense; GAAGCATGTGTTTTCCATGTCCGCG
>probe:Drosophila_2:1631264_at:4:505; Interrogation_Position=1320; Antisense; GTCCGCGGAGCGTTCAAATCTTACT
>probe:Drosophila_2:1631264_at:537:19; Interrogation_Position=1427; Antisense; ATTTCCTGCCCTTCGATGCTGAAAT
>probe:Drosophila_2:1631264_at:87:53; Interrogation_Position=1442; Antisense; ATGCTGAAATGCCTCACACGGACTT
>probe:Drosophila_2:1631264_at:462:445; Interrogation_Position=1497; Antisense; GATGCATCTTGATTACATTCCCCGC
>probe:Drosophila_2:1631264_at:58:301; Interrogation_Position=1519; Antisense; CGCCTGTTGTGGCAAGCTCAGTTAA
>probe:Drosophila_2:1631264_at:669:183; Interrogation_Position=1549; Antisense; AACAAGACCTGGTTTCTGGCACCTG
>probe:Drosophila_2:1631264_at:303:619; Interrogation_Position=1572; Antisense; TGCTCCTGAATGTGACCACCAGTGT
>probe:Drosophila_2:1631264_at:712:629; Interrogation_Position=1606; Antisense; TCCTTCTATGTGGAGCCCGGAGATG
>probe:Drosophila_2:1631264_at:401:467; Interrogation_Position=1635; Antisense; GTTGGTGGACACACGCATCTGGTAC
>probe:Drosophila_2:1631264_at:4:675; Interrogation_Position=1657; Antisense; TACCATGCCAATTCAATTCCCAAGG
>probe:Drosophila_2:1631264_at:137:1; Interrogation_Position=1672; Antisense; ATTCCCAAGGGTCAGTTTTCGCTCA
>probe:Drosophila_2:1631264_at:247:281; Interrogation_Position=1693; Antisense; CTCACCGTTCAGTCCGAGTATGGAT
>probe:Drosophila_2:1631264_at:600:445; Interrogation_Position=1720; Antisense; GATGCACCTTGTAGTTCTGAGACTC

Paste this into a BLAST search page for me
GAAGCATGTGTTTTCCATGTCCGCGGTCCGCGGAGCGTTCAAATCTTACTATTTCCTGCCCTTCGATGCTGAAATATGCTGAAATGCCTCACACGGACTTGATGCATCTTGATTACATTCCCCGCCGCCTGTTGTGGCAAGCTCAGTTAAAACAAGACCTGGTTTCTGGCACCTGTGCTCCTGAATGTGACCACCAGTGTTCCTTCTATGTGGAGCCCGGAGATGGTTGGTGGACACACGCATCTGGTACTACCATGCCAATTCAATTCCCAAGGATTCCCAAGGGTCAGTTTTCGCTCACTCACCGTTCAGTCCGAGTATGGATGATGCACCTTGTAGTTCTGAGACTC

Full Affymetrix probeset data:

Annotations for 1631264_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime