Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631265_at:

>probe:Drosophila_2:1631265_at:157:723; Interrogation_Position=2723; Antisense; TTGCCCACATTCCACCGAAAGTGTT
>probe:Drosophila_2:1631265_at:411:547; Interrogation_Position=2765; Antisense; GGATGCTGAAGAAGTTGCTGCCACA
>probe:Drosophila_2:1631265_at:102:311; Interrogation_Position=2814; Antisense; CCAATCTCCCAAAGCGGTCAAGTTG
>probe:Drosophila_2:1631265_at:114:575; Interrogation_Position=2850; Antisense; GGCGGCCATCAAGCAACCAGTGAAA
>probe:Drosophila_2:1631265_at:433:313; Interrogation_Position=2902; Antisense; GCCACCTTCAGTTTGGCTGACATGA
>probe:Drosophila_2:1631265_at:568:397; Interrogation_Position=2920; Antisense; GACATGAAATTCGACCTTCGACCTC
>probe:Drosophila_2:1631265_at:692:151; Interrogation_Position=2955; Antisense; ACAGGGCTCACCTTGGTTGCAGGGA
>probe:Drosophila_2:1631265_at:299:459; Interrogation_Position=2984; Antisense; GATATATCTATAATACCCTTCCCGC
>probe:Drosophila_2:1631265_at:461:473; Interrogation_Position=3049; Antisense; GTTAAGTCCTACATTGGCGTCGTTC
>probe:Drosophila_2:1631265_at:248:299; Interrogation_Position=3113; Antisense; CGCTCACCAGCGAGTTCGATGAGTT
>probe:Drosophila_2:1631265_at:684:637; Interrogation_Position=3128; Antisense; TCGATGAGTTCCAGCGATGGCGCAA
>probe:Drosophila_2:1631265_at:556:639; Interrogation_Position=3182; Antisense; TCGGGCGCAATCTTCAGCTGGAGTA
>probe:Drosophila_2:1631265_at:188:693; Interrogation_Position=3222; Antisense; TTTGGTGCCGTCCATGGAGATCGAC
>probe:Drosophila_2:1631265_at:193:427; Interrogation_Position=3238; Antisense; GAGATCGACGACAAGGGCAATCCCC

Paste this into a BLAST search page for me
TTGCCCACATTCCACCGAAAGTGTTGGATGCTGAAGAAGTTGCTGCCACACCAATCTCCCAAAGCGGTCAAGTTGGGCGGCCATCAAGCAACCAGTGAAAGCCACCTTCAGTTTGGCTGACATGAGACATGAAATTCGACCTTCGACCTCACAGGGCTCACCTTGGTTGCAGGGAGATATATCTATAATACCCTTCCCGCGTTAAGTCCTACATTGGCGTCGTTCCGCTCACCAGCGAGTTCGATGAGTTTCGATGAGTTCCAGCGATGGCGCAATCGGGCGCAATCTTCAGCTGGAGTATTTGGTGCCGTCCATGGAGATCGACGAGATCGACGACAAGGGCAATCCCC

Full Affymetrix probeset data:

Annotations for 1631265_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime