Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631266_a_at:

>probe:Drosophila_2:1631266_a_at:49:485; Interrogation_Position=1049; Antisense; GTATGTTGGTGCTATAGTGCTTTCA
>probe:Drosophila_2:1631266_a_at:159:603; Interrogation_Position=1090; Antisense; TGTTTCATTTTAATCGACCCACCCT
>probe:Drosophila_2:1631266_a_at:342:237; Interrogation_Position=1122; Antisense; AATCTGGGTTAGTAGCTTTGCATAA
>probe:Drosophila_2:1631266_a_at:154:511; Interrogation_Position=1158; Antisense; GTGAAGGCCGATTTCGTGATACTAA
>probe:Drosophila_2:1631266_a_at:492:83; Interrogation_Position=624; Antisense; AGTGGACCGGCCTATGTATTCGTGA
>probe:Drosophila_2:1631266_a_at:678:687; Interrogation_Position=640; Antisense; TATTCGTGATGATTGAGGCCTTGGC
>probe:Drosophila_2:1631266_a_at:106:291; Interrogation_Position=664; Antisense; CGGATGGAGCCGTTCACATGGGCAT
>probe:Drosophila_2:1631266_a_at:460:81; Interrogation_Position=693; Antisense; AGGGATCTGGCCTATCGTTTGGCAT
>probe:Drosophila_2:1631266_a_at:137:691; Interrogation_Position=710; Antisense; TTTGGCATCGCAAACAGTCCTGGGC
>probe:Drosophila_2:1631266_a_at:462:399; Interrogation_Position=753; Antisense; GACAGTGGTATGCATCCCGGACAAC
>probe:Drosophila_2:1631266_a_at:210:113; Interrogation_Position=812; Antisense; AGCAGCGGCACTCAGACAACTCGAG
>probe:Drosophila_2:1631266_a_at:236:193; Interrogation_Position=829; Antisense; AACTCGAGCTGTCAGGTTTTCGGGC
>probe:Drosophila_2:1631266_a_at:290:521; Interrogation_Position=870; Antisense; GTGGAACAGGCGACTCTGCGATGCC
>probe:Drosophila_2:1631266_a_at:688:283; Interrogation_Position=885; Antisense; CTGCGATGCCGGCAAATCTCGGGAA

Paste this into a BLAST search page for me
GTATGTTGGTGCTATAGTGCTTTCATGTTTCATTTTAATCGACCCACCCTAATCTGGGTTAGTAGCTTTGCATAAGTGAAGGCCGATTTCGTGATACTAAAGTGGACCGGCCTATGTATTCGTGATATTCGTGATGATTGAGGCCTTGGCCGGATGGAGCCGTTCACATGGGCATAGGGATCTGGCCTATCGTTTGGCATTTTGGCATCGCAAACAGTCCTGGGCGACAGTGGTATGCATCCCGGACAACAGCAGCGGCACTCAGACAACTCGAGAACTCGAGCTGTCAGGTTTTCGGGCGTGGAACAGGCGACTCTGCGATGCCCTGCGATGCCGGCAAATCTCGGGAA

Full Affymetrix probeset data:

Annotations for 1631266_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime