FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631267_at:

>probe:Drosophila_2:1631267_at:413:367; Interrogation_Position=111; Antisense; GAATCGCAATGGTCTGCTGGACTTT
>probe:Drosophila_2:1631267_at:176:539; Interrogation_Position=147; Antisense; GGTTCATGGAACTCCTTTAACTAAG
>probe:Drosophila_2:1631267_at:220:561; Interrogation_Position=17; Antisense; GGAAAATGCCTCTTGGACTACCCAT
>probe:Drosophila_2:1631267_at:657:173; Interrogation_Position=215; Antisense; AAAGCCGTTACGATAGATCACTGAA
>probe:Drosophila_2:1631267_at:446:533; Interrogation_Position=276; Antisense; GGTGTCAGACCGCTTGAATCAGAAT
>probe:Drosophila_2:1631267_at:651:403; Interrogation_Position=32; Antisense; GACTACCCATTTGGACACCATTGTT
>probe:Drosophila_2:1631267_at:547:147; Interrogation_Position=371; Antisense; ACTTTAATCAGCATCGTGACGTGGA
>probe:Drosophila_2:1631267_at:689:407; Interrogation_Position=388; Antisense; GACGTGGATGTGCTTGACAACTTTC
>probe:Drosophila_2:1631267_at:270:685; Interrogation_Position=454; Antisense; TATAAACGTGAATTCGCCAGCGATG
>probe:Drosophila_2:1631267_at:79:313; Interrogation_Position=469; Antisense; GCCAGCGATGAAGCTAATCCTTATG
>probe:Drosophila_2:1631267_at:679:129; Interrogation_Position=48; Antisense; ACCATTGTTCATCCTTTTCTTGCTT
>probe:Drosophila_2:1631267_at:52:235; Interrogation_Position=484; Antisense; AATCCTTATGTTGAGAGCCTTCAGC
>probe:Drosophila_2:1631267_at:419:57; Interrogation_Position=515; Antisense; ATGAGCCCTTACCACATGCTTATAA
>probe:Drosophila_2:1631267_at:14:205; Interrogation_Position=94; Antisense; AAGCCTTCGTTAGGTGTGAATCGCA

Paste this into a BLAST search page for me
GAATCGCAATGGTCTGCTGGACTTTGGTTCATGGAACTCCTTTAACTAAGGGAAAATGCCTCTTGGACTACCCATAAAGCCGTTACGATAGATCACTGAAGGTGTCAGACCGCTTGAATCAGAATGACTACCCATTTGGACACCATTGTTACTTTAATCAGCATCGTGACGTGGAGACGTGGATGTGCTTGACAACTTTCTATAAACGTGAATTCGCCAGCGATGGCCAGCGATGAAGCTAATCCTTATGACCATTGTTCATCCTTTTCTTGCTTAATCCTTATGTTGAGAGCCTTCAGCATGAGCCCTTACCACATGCTTATAAAAGCCTTCGTTAGGTGTGAATCGCA

Full Affymetrix probeset data:

Annotations for 1631267_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720