Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631268_at:

>probe:Drosophila_2:1631268_at:649:107; Interrogation_Position=2154; Antisense; AGAAGTTTGACTTGTACTCCACCAC
>probe:Drosophila_2:1631268_at:394:259; Interrogation_Position=2176; Antisense; CACGGTTATCCACGCATTTGCTGAA
>probe:Drosophila_2:1631268_at:635:459; Interrogation_Position=2246; Antisense; GATTTTCCACTTTTGAGTCCGAGGA
>probe:Drosophila_2:1631268_at:470:445; Interrogation_Position=2269; Antisense; GATGAACCAGCTTTATTGCGGCGCC
>probe:Drosophila_2:1631268_at:442:577; Interrogation_Position=2288; Antisense; GGCGCCTTTCTCTACAACATGTATG
>probe:Drosophila_2:1631268_at:13:599; Interrogation_Position=2335; Antisense; TGTCCGCTACCATGTTGAGAACTTC
>probe:Drosophila_2:1631268_at:624:319; Interrogation_Position=2365; Antisense; GCCCGACTCCAAGTTGATGTTCGAT
>probe:Drosophila_2:1631268_at:429:441; Interrogation_Position=2380; Antisense; GATGTTCGATTTCTATTGCTACTTG
>probe:Drosophila_2:1631268_at:529:7; Interrogation_Position=2394; Antisense; ATTGCTACTTGTACGACTGGTGCGC
>probe:Drosophila_2:1631268_at:431:533; Interrogation_Position=2412; Antisense; GGTGCGCGGAGTTTATACCAACTTG
>probe:Drosophila_2:1631268_at:713:539; Interrogation_Position=2566; Antisense; GGATGCCGATCCAGAAAACGACTTC
>probe:Drosophila_2:1631268_at:2:159; Interrogation_Position=2604; Antisense; ACAAATTCTGCGCACTCAAGGTAGC
>probe:Drosophila_2:1631268_at:402:487; Interrogation_Position=2629; Antisense; GTAGCTAGTTTGAAGTCCCGCACGT
>probe:Drosophila_2:1631268_at:9:89; Interrogation_Position=2642; Antisense; AGTCCCGCACGTGCAATTTTGAAGT

Paste this into a BLAST search page for me
AGAAGTTTGACTTGTACTCCACCACCACGGTTATCCACGCATTTGCTGAAGATTTTCCACTTTTGAGTCCGAGGAGATGAACCAGCTTTATTGCGGCGCCGGCGCCTTTCTCTACAACATGTATGTGTCCGCTACCATGTTGAGAACTTCGCCCGACTCCAAGTTGATGTTCGATGATGTTCGATTTCTATTGCTACTTGATTGCTACTTGTACGACTGGTGCGCGGTGCGCGGAGTTTATACCAACTTGGGATGCCGATCCAGAAAACGACTTCACAAATTCTGCGCACTCAAGGTAGCGTAGCTAGTTTGAAGTCCCGCACGTAGTCCCGCACGTGCAATTTTGAAGT

Full Affymetrix probeset data:

Annotations for 1631268_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime