Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631273_at:

>probe:Drosophila_2:1631273_at:581:17; Interrogation_Position=1456; Antisense; ATTTACTGGCACCTACGCAGGCACT
>probe:Drosophila_2:1631273_at:438:349; Interrogation_Position=1472; Antisense; GCAGGCACTGGCATTCAATACATTA
>probe:Drosophila_2:1631273_at:217:569; Interrogation_Position=1481; Antisense; GGCATTCAATACATTATCCCCGTTT
>probe:Drosophila_2:1631273_at:652:643; Interrogation_Position=1506; Antisense; TCTTGGTTTACTTTGCGAGACGCAC
>probe:Drosophila_2:1631273_at:511:721; Interrogation_Position=1518; Antisense; TTGCGAGACGCACTTGCTCAGAGCT
>probe:Drosophila_2:1631273_at:717:279; Interrogation_Position=1534; Antisense; CTCAGAGCTCCTGGGAAGCGGCGTA
>probe:Drosophila_2:1631273_at:493:371; Interrogation_Position=1548; Antisense; GAAGCGGCGTAGTCAATCGTTTTAA
>probe:Drosophila_2:1631273_at:592:183; Interrogation_Position=1571; Antisense; AAAAGTCCTTTCAAGTCCAGTGCCT
>probe:Drosophila_2:1631273_at:308:279; Interrogation_Position=1598; Antisense; CTAGTTTTCGTCTTCATTTGGTCAA
>probe:Drosophila_2:1631273_at:426:15; Interrogation_Position=1622; Antisense; ATTTTATGCGTCTGTTTGGTATCTA
>probe:Drosophila_2:1631273_at:550:657; Interrogation_Position=1661; Antisense; TAAGTTATCTTATCTGCCAATGTGG
>probe:Drosophila_2:1631273_at:197:571; Interrogation_Position=1697; Antisense; GGCATTGAGTTTATTACCGGCTAGT
>probe:Drosophila_2:1631273_at:203:287; Interrogation_Position=1714; Antisense; CGGCTAGTAAAGTCCCATGTCATTT
>probe:Drosophila_2:1631273_at:482:689; Interrogation_Position=1830; Antisense; TATTGAAATCGGCTGTGACACAAAT

Paste this into a BLAST search page for me
ATTTACTGGCACCTACGCAGGCACTGCAGGCACTGGCATTCAATACATTAGGCATTCAATACATTATCCCCGTTTTCTTGGTTTACTTTGCGAGACGCACTTGCGAGACGCACTTGCTCAGAGCTCTCAGAGCTCCTGGGAAGCGGCGTAGAAGCGGCGTAGTCAATCGTTTTAAAAAAGTCCTTTCAAGTCCAGTGCCTCTAGTTTTCGTCTTCATTTGGTCAAATTTTATGCGTCTGTTTGGTATCTATAAGTTATCTTATCTGCCAATGTGGGGCATTGAGTTTATTACCGGCTAGTCGGCTAGTAAAGTCCCATGTCATTTTATTGAAATCGGCTGTGACACAAAT

Full Affymetrix probeset data:

Annotations for 1631273_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime