Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631274_at:

>probe:Drosophila_2:1631274_at:164:55; Interrogation_Position=1094; Antisense; ATGCAATCAGTGATGCCGCTTTCCT
>probe:Drosophila_2:1631274_at:134:69; Interrogation_Position=1123; Antisense; AGGCTTTCTCCATCGGTGAATCGTT
>probe:Drosophila_2:1631274_at:258:477; Interrogation_Position=1145; Antisense; GTTTTACTCTCTACGTGGATCTCAG
>probe:Drosophila_2:1631274_at:557:589; Interrogation_Position=1160; Antisense; TGGATCTCAGTTCGAATCGCCTCAA
>probe:Drosophila_2:1631274_at:275:237; Interrogation_Position=1184; Antisense; AATCGTTGAACCTCAGCAGTCTTCT
>probe:Drosophila_2:1631274_at:402:349; Interrogation_Position=1199; Antisense; GCAGTCTTCTTCATTTTCGCTATAT
>probe:Drosophila_2:1631274_at:49:673; Interrogation_Position=1283; Antisense; TACCAAACTCTGTTAACTTCGCTCG
>probe:Drosophila_2:1631274_at:442:639; Interrogation_Position=1305; Antisense; TCGTCCCTGGACTGTAATCAATAAT
>probe:Drosophila_2:1631274_at:318:523; Interrogation_Position=1377; Antisense; GGGCACTAATCGTTCCATAATATTG
>probe:Drosophila_2:1631274_at:410:575; Interrogation_Position=1414; Antisense; GGCGTGCCACAACCAAAATCAGACA
>probe:Drosophila_2:1631274_at:332:247; Interrogation_Position=1438; Antisense; AATTGCGATTGTGTTGTTGCCTATG
>probe:Drosophila_2:1631274_at:522:453; Interrogation_Position=1536; Antisense; GATCATTTGGATGCTGGTGGCCATT
>probe:Drosophila_2:1631274_at:717:531; Interrogation_Position=1551; Antisense; GGTGGCCATTGCGATAGCTTTTTCA
>probe:Drosophila_2:1631274_at:472:115; Interrogation_Position=1566; Antisense; AGCTTTTTCAGGACTTCGTTGGTTG

Paste this into a BLAST search page for me
ATGCAATCAGTGATGCCGCTTTCCTAGGCTTTCTCCATCGGTGAATCGTTGTTTTACTCTCTACGTGGATCTCAGTGGATCTCAGTTCGAATCGCCTCAAAATCGTTGAACCTCAGCAGTCTTCTGCAGTCTTCTTCATTTTCGCTATATTACCAAACTCTGTTAACTTCGCTCGTCGTCCCTGGACTGTAATCAATAATGGGCACTAATCGTTCCATAATATTGGGCGTGCCACAACCAAAATCAGACAAATTGCGATTGTGTTGTTGCCTATGGATCATTTGGATGCTGGTGGCCATTGGTGGCCATTGCGATAGCTTTTTCAAGCTTTTTCAGGACTTCGTTGGTTG

Full Affymetrix probeset data:

Annotations for 1631274_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime