FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631275_at:

>probe:Drosophila_2:1631275_at:693:107; Interrogation_Position=101; Antisense; AGAAGGTTCCGCTGCCCATTCCGGT
>probe:Drosophila_2:1631275_at:338:719; Interrogation_Position=119; Antisense; TTCCGGTGCCGGTCAAGGAGCACCA
>probe:Drosophila_2:1631275_at:379:59; Interrogation_Position=13; Antisense; ATGTTCATGGGCCATTCGACCATTT
>probe:Drosophila_2:1631275_at:408:75; Interrogation_Position=134; Antisense; AGGAGCACCACCACGAGCCGAAGAA
>probe:Drosophila_2:1631275_at:154:137; Interrogation_Position=146; Antisense; ACGAGCCGAAGAAGCACCACAGCAG
>probe:Drosophila_2:1631275_at:421:309; Interrogation_Position=195; Antisense; CCACGACGACGACCAGGATGACGAT
>probe:Drosophila_2:1631275_at:523:73; Interrogation_Position=209; Antisense; AGGATGACGATTTCGAGGGCTACGA
>probe:Drosophila_2:1631275_at:718:81; Interrogation_Position=224; Antisense; AGGGCTACGAGTACCCCATCAAGGC
>probe:Drosophila_2:1631275_at:368:315; Interrogation_Position=23; Antisense; GCCATTCGACCATTTACAGGATCCG
>probe:Drosophila_2:1631275_at:719:323; Interrogation_Position=255; Antisense; GCGCACGCGGCATCCCTTTGTCTGA
>probe:Drosophila_2:1631275_at:131:547; Interrogation_Position=41; Antisense; GGATCCGAATACACGTGCCGGTGAA
>probe:Drosophila_2:1631275_at:666:533; Interrogation_Position=60; Antisense; GGTGAAGCACCACACACATGTACAC
>probe:Drosophila_2:1631275_at:376:151; Interrogation_Position=75; Antisense; ACATGTACACACGAAGACGGTCATT
>probe:Drosophila_2:1631275_at:279:405; Interrogation_Position=90; Antisense; GACGGTCATTAAGAAGGTTCCGCTG

Paste this into a BLAST search page for me
AGAAGGTTCCGCTGCCCATTCCGGTTTCCGGTGCCGGTCAAGGAGCACCAATGTTCATGGGCCATTCGACCATTTAGGAGCACCACCACGAGCCGAAGAAACGAGCCGAAGAAGCACCACAGCAGCCACGACGACGACCAGGATGACGATAGGATGACGATTTCGAGGGCTACGAAGGGCTACGAGTACCCCATCAAGGCGCCATTCGACCATTTACAGGATCCGGCGCACGCGGCATCCCTTTGTCTGAGGATCCGAATACACGTGCCGGTGAAGGTGAAGCACCACACACATGTACACACATGTACACACGAAGACGGTCATTGACGGTCATTAAGAAGGTTCCGCTG

Full Affymetrix probeset data:

Annotations for 1631275_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720