FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631277_at:

>probe:Drosophila_2:1631277_at:703:575; Interrogation_Position=1168; Antisense; GGCGCACGGCCATGAGTTGACTGTA
>probe:Drosophila_2:1631277_at:495:197; Interrogation_Position=1202; Antisense; AACGGATTGGTGGAGCTCTTCACTC
>probe:Drosophila_2:1631277_at:649:691; Interrogation_Position=1232; Antisense; TTTGTGCACGCTATGGACCGACTAA
>probe:Drosophila_2:1631277_at:7:413; Interrogation_Position=1247; Antisense; GACCGACTAATCCAATCCAGACTGA
>probe:Drosophila_2:1631277_at:153:323; Interrogation_Position=1285; Antisense; GCCCACTTACCTTTATCGATTTGAC
>probe:Drosophila_2:1631277_at:37:637; Interrogation_Position=1311; Antisense; TCGACTCGCCGGATTTTAATTTCTA
>probe:Drosophila_2:1631277_at:538:277; Interrogation_Position=1333; Antisense; CTACCGAATTCGCTTTATGGGCAAG
>probe:Drosophila_2:1631277_at:272:543; Interrogation_Position=1391; Antisense; GGATACATTTTCAAGCTGCCAGCTA
>probe:Drosophila_2:1631277_at:144:101; Interrogation_Position=1441; Antisense; AGAGTTCACAGCCATTCGCCGATTG
>probe:Drosophila_2:1631277_at:21:167; Interrogation_Position=1504; Antisense; AAATGCTCCACTCACTAAATCTCTG
>probe:Drosophila_2:1631277_at:82:467; Interrogation_Position=1532; Antisense; GATTGGAAGCCCGTAACTCGATTCG
>probe:Drosophila_2:1631277_at:192:467; Interrogation_Position=1621; Antisense; GTTGAAGTTTTTCGATCGCCTATAC
>probe:Drosophila_2:1631277_at:632:227; Interrogation_Position=1648; Antisense; AATGGCTGGAGTACCCTTATTCTAA
>probe:Drosophila_2:1631277_at:655:275; Interrogation_Position=1727; Antisense; CTTCTGATTTCACTTGCTCGACAAA

Paste this into a BLAST search page for me
GGCGCACGGCCATGAGTTGACTGTAAACGGATTGGTGGAGCTCTTCACTCTTTGTGCACGCTATGGACCGACTAAGACCGACTAATCCAATCCAGACTGAGCCCACTTACCTTTATCGATTTGACTCGACTCGCCGGATTTTAATTTCTACTACCGAATTCGCTTTATGGGCAAGGGATACATTTTCAAGCTGCCAGCTAAGAGTTCACAGCCATTCGCCGATTGAAATGCTCCACTCACTAAATCTCTGGATTGGAAGCCCGTAACTCGATTCGGTTGAAGTTTTTCGATCGCCTATACAATGGCTGGAGTACCCTTATTCTAACTTCTGATTTCACTTGCTCGACAAA

Full Affymetrix probeset data:

Annotations for 1631277_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720