Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631279_at:

>probe:Drosophila_2:1631279_at:248:467; Interrogation_Position=1045; Antisense; GTTGTTCATCTCGAAGCTGTGCACA
>probe:Drosophila_2:1631279_at:312:435; Interrogation_Position=1149; Antisense; GAGGTGTTGGCAGCGGTCCCAATCT
>probe:Drosophila_2:1631279_at:161:695; Interrogation_Position=1194; Antisense; TTTCCGGCGGCAGTCAGAGCCAAAG
>probe:Drosophila_2:1631279_at:383:539; Interrogation_Position=1229; Antisense; GGTATCTCGATACCCGAATCGGAGA
>probe:Drosophila_2:1631279_at:546:89; Interrogation_Position=1304; Antisense; AGTACGCAGGTGCTGGTCAACGACC
>probe:Drosophila_2:1631279_at:336:85; Interrogation_Position=1364; Antisense; AGTGAGACCTCATCGATCGGTGGAT
>probe:Drosophila_2:1631279_at:293:519; Interrogation_Position=1383; Antisense; GTGGATGCTCCACCATTAGCATAGA
>probe:Drosophila_2:1631279_at:262:705; Interrogation_Position=1398; Antisense; TTAGCATAGAGTCATCCTCCTGCGA
>probe:Drosophila_2:1631279_at:376:631; Interrogation_Position=1412; Antisense; TCCTCCTGCGATAGTGGTGCCAAGA
>probe:Drosophila_2:1631279_at:72:237; Interrogation_Position=1454; Antisense; AATCGCCTGGTGGTTGATTCCGATG
>probe:Drosophila_2:1631279_at:726:331; Interrogation_Position=1492; Antisense; GCTGGCCCAAAAGAGCTTCTACATT
>probe:Drosophila_2:1631279_at:704:159; Interrogation_Position=1518; Antisense; ACAAGCAGGGATTGTCGGGCGCCAA
>probe:Drosophila_2:1631279_at:630:237; Interrogation_Position=1556; Antisense; AATCACGAGCGAACGGGAGCCGTCA
>probe:Drosophila_2:1631279_at:616:415; Interrogation_Position=1572; Antisense; GAGCCGTCAGCAAAGATGTGCCGCA

Paste this into a BLAST search page for me
GTTGTTCATCTCGAAGCTGTGCACAGAGGTGTTGGCAGCGGTCCCAATCTTTTCCGGCGGCAGTCAGAGCCAAAGGGTATCTCGATACCCGAATCGGAGAAGTACGCAGGTGCTGGTCAACGACCAGTGAGACCTCATCGATCGGTGGATGTGGATGCTCCACCATTAGCATAGATTAGCATAGAGTCATCCTCCTGCGATCCTCCTGCGATAGTGGTGCCAAGAAATCGCCTGGTGGTTGATTCCGATGGCTGGCCCAAAAGAGCTTCTACATTACAAGCAGGGATTGTCGGGCGCCAAAATCACGAGCGAACGGGAGCCGTCAGAGCCGTCAGCAAAGATGTGCCGCA

Full Affymetrix probeset data:

Annotations for 1631279_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime