Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631280_at:

>probe:Drosophila_2:1631280_at:397:359; Interrogation_Position=4307; Antisense; GCAACTTGGTTTCGTTTGAGGTCTC
>probe:Drosophila_2:1631280_at:689:479; Interrogation_Position=4320; Antisense; GTTTGAGGTCTCAAGCCCAATCGAC
>probe:Drosophila_2:1631280_at:462:205; Interrogation_Position=4332; Antisense; AAGCCCAATCGACTTGCTCATAGTC
>probe:Drosophila_2:1631280_at:707:383; Interrogation_Position=4390; Antisense; GAACTACCCATCCATTCCACAAGAA
>probe:Drosophila_2:1631280_at:474:159; Interrogation_Position=4447; Antisense; ACAAAACTCCAATCGGCAGCAGCAG
>probe:Drosophila_2:1631280_at:282:655; Interrogation_Position=4482; Antisense; TAATATCGTAGTACGCGTGCCACAC
>probe:Drosophila_2:1631280_at:563:329; Interrogation_Position=4496; Antisense; GCGTGCCACACCGAACATAGTGTAT
>probe:Drosophila_2:1631280_at:690:687; Interrogation_Position=4550; Antisense; TATATTATTATTAGCCCCAACTCAC
>probe:Drosophila_2:1631280_at:186:651; Interrogation_Position=4571; Antisense; TCACCAAGCTACACCATTTCATTAT
>probe:Drosophila_2:1631280_at:222:723; Interrogation_Position=4600; Antisense; TTGTACCTACCCATTATATATCGCC
>probe:Drosophila_2:1631280_at:720:681; Interrogation_Position=4618; Antisense; TATCGCCCTGTATTTGTATTTCTAG
>probe:Drosophila_2:1631280_at:672:587; Interrogation_Position=4664; Antisense; TGTTTTCGCGTGTGTATCGTCGAGC
>probe:Drosophila_2:1631280_at:687:83; Interrogation_Position=4694; Antisense; AGTGCTAAAATGTCGCTCAGTATGC
>probe:Drosophila_2:1631280_at:638:723; Interrogation_Position=4727; Antisense; TTGAATTTCGTGCATTATTTCCAAT

Paste this into a BLAST search page for me
GCAACTTGGTTTCGTTTGAGGTCTCGTTTGAGGTCTCAAGCCCAATCGACAAGCCCAATCGACTTGCTCATAGTCGAACTACCCATCCATTCCACAAGAAACAAAACTCCAATCGGCAGCAGCAGTAATATCGTAGTACGCGTGCCACACGCGTGCCACACCGAACATAGTGTATTATATTATTATTAGCCCCAACTCACTCACCAAGCTACACCATTTCATTATTTGTACCTACCCATTATATATCGCCTATCGCCCTGTATTTGTATTTCTAGTGTTTTCGCGTGTGTATCGTCGAGCAGTGCTAAAATGTCGCTCAGTATGCTTGAATTTCGTGCATTATTTCCAAT

Full Affymetrix probeset data:

Annotations for 1631280_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime