Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631282_at:

>probe:Drosophila_2:1631282_at:628:53; Interrogation_Position=135; Antisense; ATGCAATGTCTACAAACTCAGCCCC
>probe:Drosophila_2:1631282_at:527:523; Interrogation_Position=182; Antisense; GGGCCCCATTGGAGTACTACATCAG
>probe:Drosophila_2:1631282_at:137:113; Interrogation_Position=217; Antisense; AGCACAATCAAACTGGTCTTCTTTT
>probe:Drosophila_2:1631282_at:311:537; Interrogation_Position=231; Antisense; GGTCTTCTTTTCATAGAGTCCATCG
>probe:Drosophila_2:1631282_at:17:233; Interrogation_Position=288; Antisense; AATGCAATGCCATTAACTCGCACGT
>probe:Drosophila_2:1631282_at:260:635; Interrogation_Position=305; Antisense; TCGCACGTGCCCCAAAATCAGTGAA
>probe:Drosophila_2:1631282_at:300:453; Interrogation_Position=335; Antisense; GATCAAATCGCTTGACTGGGAGCTT
>probe:Drosophila_2:1631282_at:474:553; Interrogation_Position=353; Antisense; GGAGCTTCAGGGTCTTATTCAGCCA
>probe:Drosophila_2:1631282_at:509:41; Interrogation_Position=387; Antisense; ATCGATTGGAGACTAGTCCTCGTCC
>probe:Drosophila_2:1631282_at:722:701; Interrogation_Position=420; Antisense; TTTTCCGCTTTCCACACTCAAATAT
>probe:Drosophila_2:1631282_at:315:249; Interrogation_Position=460; Antisense; CAATATTGAATGCTCTGCCTGCGGC
>probe:Drosophila_2:1631282_at:314:61; Interrogation_Position=49; Antisense; ATGTATGACAGCTGTCCCGTGTGTC
>probe:Drosophila_2:1631282_at:123:1; Interrogation_Position=530; Antisense; ACGTCCCCTTTGAGCCTAGGATATA
>probe:Drosophila_2:1631282_at:293:511; Interrogation_Position=94; Antisense; GTGAAGACGCCATGCAAGCACACAT

Paste this into a BLAST search page for me
ATGCAATGTCTACAAACTCAGCCCCGGGCCCCATTGGAGTACTACATCAGAGCACAATCAAACTGGTCTTCTTTTGGTCTTCTTTTCATAGAGTCCATCGAATGCAATGCCATTAACTCGCACGTTCGCACGTGCCCCAAAATCAGTGAAGATCAAATCGCTTGACTGGGAGCTTGGAGCTTCAGGGTCTTATTCAGCCAATCGATTGGAGACTAGTCCTCGTCCTTTTCCGCTTTCCACACTCAAATATCAATATTGAATGCTCTGCCTGCGGCATGTATGACAGCTGTCCCGTGTGTCACGTCCCCTTTGAGCCTAGGATATAGTGAAGACGCCATGCAAGCACACAT

Full Affymetrix probeset data:

Annotations for 1631282_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime